Open Access

Identification, cross-taxon transferability and application of full-length cDNA SSR markers in Phyllostachys pubescens

  • Yuan Lin1,
  • Jiang-Jie Lu1,
  • Miao-Dan Wu1,
  • Ming-Bing Zhou1,
  • Wei Fang1,
  • Yuji Ide2 and
  • Ding-Qin Tang1, 2Email author
SpringerPlus20143:486

https://doi.org/10.1186/2193-1801-3-486

Received: 26 May 2014

Accepted: 11 August 2014

Published: 29 August 2014

Abstract

Current databases of Phyllostachys pubescens full-length cDNAs (FL-cDNAs) provide a rich source of sequences for the development of potential FL-cDNA simple sequence repeat (SSR) markers. We screened 10,608 P. pubescens cDNAs, discovering 1614 SSRs in 1382 SSR-containing FL-cDNAs. The SSRs were more abundant within transposable elements (TEs) than expressed sequence tags (ESTs) and genome survey sequences (GSSs), and specific dinucleotide repeats tended to associate with particular TE families: (TA)n with En/Spm and (CT)n with Mutator. A selected panel of 100 FL-cDNAs containing type I SSRs yielded 68 functional SSR markers with an average polymorphism information content (PIC) value of 0.12, among which 22 loci contained polymorphisms. These markers became less transferrable (83.1% → 69.9% → 49.3%) but more polymorphic (79.4% → 92.3% → 92.8%) with increasing phylogenetic distance (intra-genus → intra-subtribe → intra-family). Transferability and polymorphism also depended on the location of the marker, with those located in the coding region being more transferrable (69.1%) and less polymorphic (89.4%) than those in the 5′-UTR (63.4% transferable, 90.7% polymorphic) and the 3′-UTR (61.8% transferable, 91.4% polymorphic). As proof of principle, we were able to use our FL-cDNA SSR markers to identify the parental stocks in interspecific hybrids of bamboo within and beyond P. pubescens, and estimate the outcrossing rate for P. pubescens. Our research should facilitate molecular breeding in bamboo species where original genetic markers are scarce.

Keywords

Phyllostachys pubescens (edulis) Microsatellite (SSR) Cross-taxon transferability /polymorphism Hybrid identification Outcrossing-rate estimation

Background

Bambusoideae is a subfamily of the grass family Poaceae and is further divided into nine subtribes comprising more than 80 bamboo genera and about 1400 species worldwide. Fifty genera and more than 500 species are found in China, among which Phyllostachys pubescens (synonym: P. edulis) is commercially the most important species providing the third largest source of timber and the most predominant source of bamboo shoots. P. pubescens plantations cover an area of 3 million ha (approximately 2% of the total forest area), which has doubled over the last 30 years and taken on a more important ecological role (Fu 2001). Compounds extracted from P. pubescens have recently shown potential for the treatment of obesity and other diseases (Higa et al. 2012). However, various problems associated with P. pubescens plantations including its simultaneous flowering intervals of more than 60 years and recovers from a limited number of clones (Janzen 1976; Watanabe et al. 1982). Additionally, the little knowledge of its basic biology, genetics and breeding system bring about the practical difficulties associated with the identification and characterization of superior genotypes.

Molecular markers developing from microsatellites, also known as simple sequence repeats (SSRs) with characterization of high genome coverage, random dispersion, co-dominant inheritance, reproducibility and amenability to automation in high throughout genotyping, have gained considerable spotlight recently. By now, microsatellite markers have been developed for several other bamboo species, e.g. six loci for Bambusa arundinacea (Nayak and Rout 2005), eight loci for Sasa senanensis (Miyazaki et al. 2009) and eight loci for S. cernua (Kitamura and Kawahara 2009). We identified 19 GenBank microsatellite markers in P. pubescens and related species (Tang et al. 2010), and 15 expressed sequence tag (EST) SSR markers for Bambusa species (Dong et al. 2011). Recently, the Bamboo Full-Length cDNA Project (Peng et al. 2010) has generated a vast amount of publicly-available P. pubescens cDNA sequence data that can be used for gene discovery, comparative genomics/transcriptomics and marker development. Microsatellites derived from cDNAs or ESTs are highly transferable to closely related species (Zhang et al. 2005) facilitating the development of gene-based maps that may increase the efficiency of marker-assisted selection through the use of candidate genes (Rossi et al. 2003; Lu et al. 2006).

Here, we report the use of P. pubescens full-length cDNA (FL-cDNA) sequences to 1) analyze the association between SSRs and transposable elements (TEs) in the transcriptome; 2) develop and validate FL-cDNA SSR markers and determine their transferability to other bamboo species; and 3) apply the polymorphic SSR markers to estimate outcrossing rates in P. pubescens and identify bamboo interspecies hybrids.

Results and discussion

Association between SSRs and TEs in the P. pubescens transcriptome

We analyzed 10,608 P. pubescens FL-cDNA sequences available in NCBI GenBank, representing ~7171 kb of DNA. EST-trimmer was used to remove poly(A/T) runs, and the remaining sequence data were screened using MISA, identifying 2330 SSRs in 2014 cDNAs, the remaining cDNAs lacking SSRs. The sequences were clustered with CAP3, reducing the collection to 1614 non-redundant SSRs in 1382 cDNA contigs (Additional file 1: Figure S1). Peng et al. (2010) described the distribution of SSRs in the P. pubescens transcriptome in detail. Therefore, we selectively analyzed the non-redundant cDNA sequences and contigs with RepeatMasker to determine the association between SSRs and TEs because previous reports have shown that many SSRs are located in TEs (Richard et al. 2008), e.g. 50% of SSRs in the human genome (Scherer 2008), and that SSRs are closely associated with TEs in rice (Akagi et al. 2001; Temnykh et al. 2001) and barley (Wei et al. 2002). The results revealed 95 TEs, representing 13.52 kb (0.27%) of the total cDNA sequence data. Further analysis showed that 29 TEs contained a total of 39 SSRs, accounting for 822 bp (6.41%) of the total TE DNA sequences. In comparison, the non-redundant EST sequence data (7089 cDNAs refined from the original 10,608 sequences) contained 1614 SSRs, accounting for 2.60% of the total cDNA sequences in length. Therefore, SSRs were approximately 2.5-, 65.4-fold more abundant in TEs compared to cDNAs (Table 1) and whole genome (0.098% based on the analysis of genome survey sequences (GSSs; Tang et al. 2010)). It is possible that SSRs within TEs are also involved in the regulation of gene expression (Tomilin 2008).
Table 1

Association between FL-cDNA SSRs and transposable elements (TEs) in P. pubescens

TE family

No.

Length (bp)

No. of TE-SSR

No. of SSR-TE

TE-SSR/SSR-TE (%) (in length )

No. of SSRs with repeat units of:

1 nt

2 nt

3 nt

4 nt

5 nt

6 nt

Total TEs

95

13522

36

29

6.08

1

31

4

0

1

0

  En/Spm

8

815

6

5

33.87

0

5

1

0

1

0

Mutator

28

2931

13

12

14.19

1

10

2

0

0

0

  Ty1-copia

20

4010

1

1

0.3

0

0

1

0

0

0

  Ty3-gyspy

17

2913

0

0

0

0

0

0

0

0

0

  Other TEs

22

2853

16

11

8.70

0

16

0

0

0

0

EST

7089

4942281

1614

N.A.

2.60

271

489

789

30

14

21

Some studies have also suggested associations between specific SSR motifs and particular TE families, e.g. (TA)n is often found in the 5′-UTR of Micron element transposase genes in rice (Akagi et al. 2001; Temnykh et al. 2001). We also investigated the distribution of SSRs among DNA transposons, and found they were most likely to occur in En/Spm elements (33.87% of the total En/Spm DNA sequence). Six SSRs were found in five En/Spm elements, with one element containing two SSRs (Table 2). Mutator elements were the next most likely to contain SSRs (14.19% of the total Mutator DNA sequence). Thirteen SSRs were found in 12 Mutator elements, again with one element containing two SSRs (Table 2). The situation was very different among retrotransposons, with only 0.30% of the total Ty1-copia DNA sequence and 0% of Ty3-gypsy DNA sequence made up of SSRs. More detailed investigation of specific repeat motifs showed that four of the six SSRs found in En/Spm elements were TA/AT repeats, and 10 of the 13 SSRs found in Mutator elements were CT/AG repeats. All 13 of the Mutator SSRs and six of the En/Spm SSRs were located in the 5′-UTR. It has been reported that TE molecular markers (mPing) showed significantly higher levels of polymorphism than all other molecular markers in closely-related rice cultivars (Monden et al. 2009). Considering that it is difficult to detect genetic variation in P. pubescens using ordinary markers (Lin et al. 2009; Tang et al. 2010), SSRs in TEs therefore appear to be promising markers for bamboo species.
Table 2

Distribution of SSRs in En/Spm and Mutator transposons

ID

SSR motifs

Length (bp)

Starting

Ending

Location

SSR distribution in En/Spm transposons

FP091991

(GAGGA)6

30

109

138

CDS

FP091422

(TA)22(CA)9

62

12

73

5′UTR

FP097776

(TA)23

46

1

46

5′UTR

FP100462

(TA)31

62

14

75

5′UTR

FP100841

(CGG)6

18

38

55

5′UTR

FP100858

(AT)29

58

22

79

5′UTR

SSR distribution in Mutator transposons

FP100733

(TC)8-(GGC)5

89

20

108

5′UTR

FP100664

(AG)17

34

32

65

5′UTR

FP094905

(CT)17

34

1

34

5′UTR

FP099988

(CT)19

38

1

38

5′UTR

FP094782

(CT)12

24

7

30

5′UTR

FP099842

(CT)15

30

4

33

5′UTR

FP091749

(CT)23

46

2

47

5′UTR

FP093400

(GA)16

32

23

54

5′UTR

FP096707

(GAA)8

24

36

59

5′UTR

FP096801

(TC)8

16

2

17

5′UTR

FP099127

(AG)18

36

40

75

5′UTR

FP099725

(C)13

13

1

13

5′UTR

Development and polymorphism assessment of FL-cDNA SSR markers for P. pubescens

Original collection of 10,680 P. pubescens FL-cDNA sequences produced 1382 cDNA contigs containing SSRs. Sequences containing mononucleotide repeat motifs were excluded, leaving 1051 cDNA sequences containing SSRs with 2–6 nt repeats motifs (Additional file 1: Figure S1). Following the procedure already adopted for rice (Temnykh et al. 2001). We were able to design primer pairs for 583 (55%) of these cDNAs, the remainder offering either insufficient flanking DNA (over half of the SSRs were found in the 5′ or 3′ UTRs) or flanking DNA that was unsuitable for primer design. Only 325 (24.1%) of the SSRs were type I repeats (>20 bp), which offer greater potential for marker development. The 100 most promising sequences were selected for PCR validation, including dinucleotide repeats with ≥12 repeat units, trinucleotide repeats with ≥8 repeat units, tetranucleotide repeats with ≥6 repeat units, pentanucleotide and hexanucleotide repeats with ≥5 repeat units and some compound SSRs with >24 repeats (Table 3). We found that 32 of the selected cDNAs were unsuitable because the PCR failed to generate a product (four cDNAs) or generated products lacking SSRs (28 cDNAs), but the remaining 68 sequences allowed the development of FL-cDNA SSR markers (Table 3). These contained 18 compound SSRs, 19 dinucleotide repeats, 18 trinucleotide repeats, four tetranucleotide repeats, three pentanucleotide repeats and six hexanucleotide repeats. Interestingly, although 45 of the cDNAs (66.2%) generated the anticipated PCR product, 16 (23.5%) generated products with more repeats than expected, five (7.4%) generated products with fewer repeats than expected, and two (PBM050 and PBM055) generated products with different repeats and flanking sequences than those anticipated. The unanticipated amplification resulted in three SSR markers (PBM036, PBM055 and PBM 077) containing type II repeats (12–19 bp in length) and one marker (PBM079) shorter than 12 bp. In total, 67 sequences were deposited in GenBank (accession nos GU644371–GU644438). Based on BLASTX analysis, putative functions were assigned to most (66.2%) of the cDNA sequences with significant similarity to known proteins, whereas 27.9% matched unknown/hypothetical proteins and 5.9% were novel sequences (Table 3).
Table 3

Characteristics of the P. pubescens SSR markers derived from FL-cDNAs

No.

Marker

Accession no.

Primer sequence (5′→ 3′)

Motif

Tm (°C)

PCR fragment (bp)

 PIC

Putative function

Name

cDNA

SSR

1

PBM031

FP094740

GU644371

CGCCGAGTTCCCTATTATTATTT

(AG)6-(AG)7

56

191

0

MYB-like transcription factor

    

AGCACAGCCTCCGTGATTG

     

2

PBM032

FP098085

GU644372

TTTCCCAAATAAAACCTCACC

(CCG)7-(CCT)6

56

143

0

PHD finger protein

    

GTCCATTTAGGGTTCCACTGA

     

3

PBM033

FP099510

GU644373

CTGACTGTGCGTGCGTCTC

(CG)8(AG)14

56

155

0

Small GTP-binding protein

    

CTTGGTCTCGCTCATCTCCTC

     

4

PBM034

FP098748

GU644374

TCGGCTCGGCGTGATGGAT

(GAG)5(GCG)5

62

169

0

GTP binding protein

    

ATCGGCATCCGCGACTGCC

     

5

PBM035

FP100911

GU644375

ACCGTGATGACTACCGCCGCGACC

(GTG)7-(GTG)7

62

165

0.368

U2 snRNP auxiliary factor

    

TGCTGCCTCCACCCCTCCGTCC

     

6

PBM036

FP096684

GU644376

CACATGGACCGCCTCATCC

(TA)8

47

169

0.259

Polypeptide-associated complex alpha subunit-like protein

    

GCAACAAAACGAGAACCAGAC

     

7

PBM037

FP101192

GU644377

TGCAAGCCTGCTATACGTTT

(TA)7-(TA)6

47

130

0

Thaumatin family protein

    

GAAGTGGGAGTACATACTTCCCA

     

8

PBM038

FP101125

GU644378

GGTCGGCTCATTTTGTAGTGT

(TC)9(TA)22

48

210

0.365

GCIP-interacting family protein-like

    

CAACCTTCAGGCAATAGATTACAT

     

9

PBM039

FP091409

GU644379

CATCCTCAGTTTCTCACCG

(TC)12-(CTT)6

53

171

0.355

Unknown protein

    

CAGCTTCACCAACTTGTGG

     

10

PBM040

FP096343

GU644380

GAATCATCTGGGAAGAAGAAGGA

(TC)7-(TC)7

51

178

0

Bicolor hypothetical protein

    

TGCATTGCATTTGGCTTAGTAGT

     

11

PBM041

FP095242

GU644381

TGGTGTTGCCTGTGACCTTAC

(TG)8(AG)10

53

167

0

typeA response regulator 1

    

CCCACCTCCACCTCTACTACG

     

12

PBM042

FP093940

GU644382

TCCTTTACGGCTTTACCCC

(GA)7-(AG)6

53

156

0.365

SAM and SH3 domain-containing protein 1

    

GCCCCAGCTTAGTACACCAC

     

13

PBM043

FP099127

GU644383

CTCACCGCCCCACCTCGCA

(AG)13

60

128

0

IAA15 - auxin-responsive Aux/IAA family member

    

CGGCTGCTGATGCGGAGGA

     

14

PBM044

FP095585

GU644384

AAGGCCCACGTTGCCAGAC

(AG)20

55

173

0.371

Bicolor hypothetical protein

    

GTTCCCGTTGATGCCCCAC

     

15

PBM045

FP098751

GU644385

TGAGCGAGGTAGTTTCATTTTAGTTA

(CA)20

53

132

0.322

DRE binding factor

    

CCTACGACGAGTAGATTGCGAGT

     

16

PBM046

FP094276

GU644386

CTCAGAGCAGACACTGCTTATTCC

(CT)5-(CT)6

50

102

0.395

Unknown protein

    

GCGTCTTCATTGCAGCCATCT

     

17

PBM047

FP099829

GU644387

ACCACGTTGCAGGATTCACT

(CT)13

53

119

0

Bicolor hypothetical protein

    

CGATGAGCAGCACAACAGC

     

18

PBM048

FP092637

GU644388

GCAAAAGAGCGCACTTGAC

(CT)27

53

163

0

Serine carboxypeptidase 1 precursor

    

GGAGGACACTAGAGTTGGCATT

     

19

PBM049

FP099913

GU644389

ACAGCAGATAGTCCCAAAAT

(GA)14

50

117

0.305

Unknown protein

    

GACAGCAGGATGAAGAGCA

     

20

PBM050

FP093015

GU644390

AGTATAGTATGTTCGTTTAAGTGG

(CA)11

45

137

0

Oxidoreductase

    

TGTAATGTTTAAGGTTCCGT

     

21

PBM051

FP092618

GU644391

AGACATTGTCAACTGTAAGTTGGTAGAG

(TC)23

50

111

0

VQ motif family protein

  

(FP099842)

 

TTTACAAGCAATACACCCAGAAATAG

     

22

PBM052

FP095787

GU644392

AGCGGGCAGGCTATGTATT

(TCT)11

51

140

0.359

ELF4-like protein

    

TTGCTTCTCCCCTAATGACA

     

23

PBM053

FP094717

GU644393

CCCCATAATCTGCTCCCTTCT

(TTC)10

51

102

0

KN1-type homeobox transcription factor

    

GGTTCTTGGCGTATGGTATGTTC

     

24

PBM054

FP100158

GU644394

ATCGGGAGGGATGCGGCAGC

(GGCGGA)6

62

121

0.305

Unknown protein

    

GCGGACCAAGCGGAACACC

     

25

PBM055

FP100601

GU644395

CATGGATGTTGTTGAGTTGAGGC

(TC)7

53

199

0

Nonspecific lipid-transfer protein 2 precursor

    

GCACAAAGACTAGTACTCGAGGTGG

     

26

PBM056

FP100601

GU644396

CATGGATGTTGTTGAGTTGAGGC

(CTCCAT)6

53

177

0

Nonspecific lipid-transfer protein 2 precursor

    

GCACAAAGACTAGTACTCGAGGTGG

     

27

PBM057

FP097951

GU644397

CGCCCACCCCTCCTTCGTCT

(ACACAG)5

59

111

0

Cp protein

    

TCCTTGGCACGGCCACTCA

     

28

PBM058

FP097794

GU644398

GGCCGAGATCCTCCTTTCT

(GGCGGT)5

59

171

0

Unknown protein

    

CCATCCCCGCCTTCACCAC

     

29

PBM059

FP094127

GU644399

ATTAGTCACGCACCGAGAAGGAA

(AGATG)6

55

172

0

Transcription elongation factor-related protein

    

AGACGCAAGAACTCGACAGGGA

     

30

PBM060

FP101691

GU644400

CACGCCAGCTCCAGATGCCACCAT

(CACCC)5

59

119

0

Sucrose transporter

    

TGCCCTTCCACCTCCTCTGACCTCC

     

31

PBM061

FP095238

GU644401

CCCTATCCCATCCTCCTCCC

(CCTCT)5

55

119

0

Smr domain containing protein

    

GGTTGCTCACTTTCCTGCTCC

     

32

PBM062

FP096136

GU644402

TGCTGGTTGGGTTCATCACGA

(TTCT)7

53

156

0

Bicolor hypothetical protein

    

GAGGGTTACAACAGGGGCAAAGA

     

33

PBM063

FP098746

GU644403

CAACGCAACGCCATTCCAAACA

(TCCA)5

59

138

0

U-box domain containing protein

    

CACCTCCAGGCCCTGGTACTCCA

     

34

PBM064

FP099572

GU644404

CATTTCTCATTGCCGCTGTAAC

(GAGT)5

53

139

0

Unknown protein

    

TCCTTTGCCCTCCTCTTCCT

     

35

PBM065

FP096965

GU644405

GTCAGTCAGGCGGCACGAG

(CG)5-(CGG)9

60

183

0

Bicolor hypothetical protein

    

CGCGTAGGACGAGATCACCTC

     

36

PBM066

FP095562

GU644406

CTCTTCACCGAAACCGAAAG

(CGG)9

57

137

0.477

Spliceosomal protein

    

CGTTGAGGTTCCTGAGGTAGAC

     

37

PBM067

FP098504

GU644407

GGTGCGGGTGCAGTTTATT

(CTT)8

51

185

0

RNA-binding protein

    

AGCATCATCCGCCAGAATA

     

38

PBM068

FP093884

GU644408

AACCGTGCACTACTTGCTCT

(TCT)8

51

155

0

pollenless3 mRNA

    

ACCTTGTGGACGACATGGA

     

39

PBM069

FP099427

GU644409

CCCTTTCCCTTCAACAACAA

(CCG)8

57

101

0.360

Alba superfamily protein

    

TACCGATCCATGGCTCCTT

     

40

PBM070

FP094239

GU644410

TCGTGCCTTTCGCCTCCTG

(TCT)7

55

117

0

Bicolor hypothetical protein

    

CTGTACGGCCCGAACTTGTA

     

41

PBM071

FP093953

GU644411

AGCGTCACCTCCGCCTTCT

(CGA)8

57

101

0

Unknown protein

    

TCCTTGGCCTCGTCTTGGT

     

42

PBM072

FP093285

GU644412

CCTCCCACTGTCACGGCACC

(CTC)9

59

116

0

Bicolor hypothetical protein

    

GGCTGTGGCGACAAGGCTG

     

43

PBM073

FP096973

GU644413

AGCAGCTCTACGGCAAGAAGAAG

(ATC)8

53

139

0

Bicolor hypothetical protein

    

TGCAGCCTTGAGGAATTGAGAA

     

44

PBM074

FP096816

GU644414

CCCACCGAAGTAATCACGC

(CTC)8

55

119

0

Transcription factor HBP-1a(c14)

    

CTCGCACAACAAAAGAAATCA

     

45

PBM075

FP096707

GU644415

AGTTTCCTTCTTTCCTTCCTTCCGTGGTG

(GAA)8

53

101

0.510

Unknown protein

    

CGGCATTTGCGATTTGTGC

     

46

PBM076

FP101632

GU644416

ATGCCTTCACCACACTTAC

(GCA)8

51

121

0

AP2/ERF domain protein

    

CATCGTGATGTCTCCAATC

     

47

PBM077

FP096443

GU644417

CCGCTTCCTCCCACCAAAT

(CCG)5

59

181

0

Bicolor hypothetical protein

    

CGCAGTACAGCAGCTCCCC

     

48

PBM078

FP095554

GU644418

CCCAAATCCAACCAGAACCA

(CGG)11

59

187

0

Anti-silencing protein

    

GGAGGAGGCATTCGTAGGAGA

     

49

PBM079

FP097911

GU644419

AAGGATGGTAACGTACATACA

(AT)5

44

159

0

Unknown protein

  

(FP092888)

 

CATGACAAATTTAAAGGTATCA

     

50

PBM080

FP093425

GU644420

CGAGGTTCTTGGGCTCAGTT

(AG)13

53

116

0.375

ATP binding protein

    

ACACGCCTCCAATAAAACAAAC

     

51

PBM081

FP097485

GU644421

TCTACTCCGTAGCCGCCTTC

(CT)16

56

135

0

Pyridoxamine 5-phosphate oxidase

    

AGAGCCTCCATTGGATGGG

     

52

PBM082

FP099753

GU644422

AATTTGTTGCCCTGCCTAGCT

(TC)5-(TC)16

53

148

0

Homeodomain leucine-zipper protein Hox8

    

GCAAGATGAGAAGAATTAAAGCTGC

     

53

PBM083

FP101428

GU644423

CCATTTGGCATTTGCTCCC

(GA)15

59

186

0

GTPase SAR1 (Sar1.1)

    

GCACCCCGTAGAACCAGTCC

     

54

PBM084

FP092513

GU644424

CTTCTCATGGGGTCAGCTACTC

(TC)17(AC)16

53

201

0.369

Brown planthopper-induced resistance protein 1 (Bi1)

    

ATCACTTCTGCGATCTTGGTC

     

55

PBM085

FP091409

GU644425

GGGGAGCCATCCTCAGTTT

(TC)12-(CTT)6

55

183

0.346

Putative precursor micro RNA R167h gene

    

GCTGGCAGCTTCACCAACT

     

56

PBM086

FP096167

GU644426

GTGGAAAATAAAGAAGCGC

(TC)9-(TC)9

51

139

0

Unknown protein

    

TTCCTGCTTTTGATCTTGC

     

57

PBM087

FP093957

GU644427

ACCCCAAGCATCCCCAAAA

(CCT)5-(CGC)9

59

166

0.373

Bicolor hypothetical protein

    

CCGCAGGGAAGTCGAAGGTC

     

58

PBM088

FP091571

GU644428

GTGTATTGGCTTTCCAGCTTTTCC

(AG)11

55

211

0

Knotted class 1 homeodomain protein

    

TCTCCGCACGCTACTGTCCC

     

59

PBM089

FP097920

GU644429

TCCCTTATCCACCAAACACGC

(CT)17

56

172

0.369

Bicolor hypothetical protein

    

GCTGGCAACGACGCACCTC

     

60

PBM090

FP097267

GU644430

AGAGTCGGATAAGGGTAGCG

(AG)12

53

106

0.195

Repair protein RAD23

    

CGATCTCGAAGTTCGTGCC

     

61

PBM091

FP100553

GU644431

ATAGAGGCATACAGCCGCAGAC

(AG)14

56

126

0.369

Macrophage migration inhibitory factor

    

TAGGCACGGCATCACGGAC

     

62

PBM092

FP099642

GU644432

GAACGCCGCATCCAGCCTCT

(TC)13

53

155

0

Basic/leucine zipper protein

    

GGTCGGGTCCTTGGACAAAC

     

63

PBM093

FP100738

GU644433

TCGCAGTAAACAGTCTCATCACATC

(CCT)8

59

150

0

Disulfide isomerase (PDIL2-2)

    

TCAGGGCCACCACCTCGTCT

     

64

PBM094

FP095169

GU644434

GATTGAGGAGCCCCAAACC

(CCG)8

57

257

0

DUF2372 superfamily protein

    

CACAACAACCGCAAGAGCC

     

65

PBM095

FP098630

GU644435

TTATTAGTCGAGTTTGGGTCTCC

(CCT)8

55

115

0.430

Unknown protein

    

GGTGAACGGCATGGCTGCT

     

66

PBM096

FP100124

GU644436

CACTCGGCTCGTCCTCGTCT

(CCTC)6

60

129

0

PLAC8 superfamily protein

    

AGGGTGGCTAAGGCTCGTCTC

     

67

PBM097

FP099849

GU644437

CTGCCACTCCATCCCTGCC

(CACGCG)5

59

101

0

Unknown protein

    

CTCGATGGCGACGGCTGTT

     

68

PBM098

FP097471

GU644438

CCCCGTCTTCTCGTCGTCT

(TCGCCG)5

56

169

0

BAH_BAHCC1 superfamily protein

    

GACTTTGTCGGAGCCCTTGA

     

One hundred and seven primer pairs finally yielded 68 FL-cDNA SSR markers for P. pubescens, which is towards the lower end of the 60–90% success rate previously reported in sugarcane (Cordeiro et al. 2001), barley (Thiel et al. 2003), wheat (Yu et al. 2004) and peanut (Liang et al. 2009). Squirrell et al. (2003) defined the successive loss of sequenced fragments and designed primers, until arriving at a final collection of “working SSRs” producing discrete bands of the expected size, as the “attrition rate”. Kofler et al. (2008) reported a high attrition rate when developing SSR markers from enriched libraries, BAC-end sequences and ESTs in rye, possibly reflecting the large number of TEs in the rye genome. Tero et al. (2006) found that the number of SSR markers was reduced when the markers were predominantly located within TEs. Squirrell et al. (2003) suggested that SSR marker development would be challenging in polypoid species and species such as wheat and rye with large numbers of TEs. P. pubescens has 2n = 48 chromosomes and is thought to be tetraploid (Li et al. 1999). The genome is >2000 Mb, which is approximately 5.4 times larger than diploid cultivated rice (Gui et al. 2007), and it contains a large number of TEs (Zhong et al. 2010; Zhou et al. 2010a, [b], [c]). The slightly higher attrition rate we encountered therefore seems reasonable when considering the chromosomal polyploidy, size and TE content of the genome. We also encountered a higher attrition rate in B. oldhamii (Li et al. 2001), a hexaploid bamboo species with a large genome (data unpublished) in which we developed 15 EST-SSR markers from 52 promising sequences selected from 3406 non-redundant ESTs (Dong et al. 2011).

We surveyed the allelic variability of the markers by genotyping 50 open-pollinated seedlings germinated from the year 2010 seedlot (Table 3). Among the 68 FL-cDNA SSR markers, only 22 (32.4%) showed polymorphism. The polymorphism information content (PIC) values of the 68 markers ranged from 0 to 0.51 with a mean value of 0.12. For the 22 polymorphic loci, the PIC values ranged from 0.19 to 0.51 with a mean value of 0.36, and the top ten markers in terms of polymorphism were PBM075, PBM069, PBM095, PBM046, PBM066, PBM080, PBm087, PBM044, PBM084 and PBM091. SSR polymorphism in P. pubescens is much lower than observed in cereals (Thiel et al. 2003; Yu et al. 2004), coffee (Aggarwal et al. 2007) and the rubber tree (Feng et al. 2009). Bamboo P. pubescens has a long flowering interval of more than 60 years (Janzen 1976; Watanabe et al. 1982). Therefore, open pollination (DNA recombination) appears to have limited the amount of replication slippage, which diversifies SSR alleles (Richards and Sutherland 1994; Jakupiak and Wells 1999). Clonal propagation in the interim periods of flowering has reduced the SSR diversity in bamboo (Nayak and Rout 2005). In a previous study, we discovered almost no allelic variation in the panel of 11 varieties and 17 provenances of P. pubescens using 19 GSS-SSRs (Tang et al. 2010).

Interspecific transferability and polymorphism of P. pubescens FL-cDNA SSR markers

Although more than 1000 bamboo species have been described, the vast majority of publically-available sequence data are derived from P. pubescens (Tang 2009). Therefore, the development of a set of transferable P. pubescens FL-cDNA SSR markers suitable for other bamboo species would help to accelerate genetic research and comparative genomics in the Bambusoideae subfamily. Previously, we developed 19 P. pubescens GSS-SSR markers and successfully transferred them to six other Phyllostachys species with an average transferability of 75.3% and 66.7% polymorphism (Tang et al. 2010). In B. arundinacea, 100% and 83.3% transferability were achieved with 6 SSR markers in eight other Bambusa species and 10 species of other genera, respectively (Nayak and Rout 2005). In B. oldhamii, we achieved an average 59.6% transferability and 51.4% polymorphism with 15 markers in 14 bamboo species including four species within the same genus (Dong et al. 2011). We tested the transferability and polymorphism of these 68 putative FL-cDNA SSR markers across 41 diverse species in six tribes of the Bambusoideae subfamily, as defined by Das et al. (2008) and Yang et al. (2008) (Additional file 2: Table S1 and Additional file 3: Table S2). Successful amplification became less likely with increasing phylogenetic distance from P. pubescens, with an 83.1% success rate within the genus Phyllostachys, a 79.4% success rate across genera within the subtribe Shibataeeae, and a 49.3% average success rate for other subtribes, ranging from 36.8–76.5% (Table 4 and Figure 1). In contrast, the number of markers showing polymorphism increased with phylogenetic distance, with 79.4% of markers showing polymorphism within the genus Phyllostachys, 91.3% showing polymorphism within the Shibataeeae, and 92.8% showing polymorphism when comparing other subtribes. Markers in coding sequences were on average the most transferrable (69.1%) and the least polymorphic (89.4%), compared to those located in 5′-UTRs (63.4% transferrable, 90.7% polymorphic) and 3′-UTRs (61.8% transferrable, 91.4% polymorphic). These trends were exacerbated with increasing phylogenetic distance. These matches the results from a metastudy of 601 loci in 35 plant species showing an average 89.8% transferability at the subgenus level, 76.4% at the genus level and 35.2% at the family level (Rossetto 2001). Interestingly, more than 17 (25%) of the markers were transferrable to more than 85% of the tested species (Additional file 3: Table S2). This success rate suggests that FL-cDNA SSRs and their flanking regions are sufficiently conserved (Zhang et al. 2005), and it is therefore possible to transfer P. pubescens FL-cDNA SSR markers to other bamboo species for evolutionary studies and phylogenetic reconstructions (Sharma et al. 2008).
Table 4

Transferability/polymorphism of P. pubescens FL-cDNA-derived SSR markers across species and genera in the Bambusoideae subfamily

Types of EST-SSR (number)

Intra-genus (Phyllostachys)

Inter-genus within substribe (Shibataeeae)

Inter-substribe

Average

Melocanninae

Bambusinae

Chusqueeae

Arundinarieae

Guaduinae

5′-UTR (41)

85.8%/81.4%

69.2%/91.3%

42.7%/93.6%

35.5%/94.4%

41.5%/88.2%

78.1%/91.4%

29.3%/90.9%

63.4%/90.7%

ORF (18)

80.6%/71.3%

70.1%/91.0%

58.3%/97.7%

57.1%/95.7%

61.1%/90.9%

75.6%/89.1%

55.6%/95.8%

69.1%/89.4%

3′-UTR (9)

75.9%/86.6%

72.2%/91.7%

41.7%/95.0%

46.0%/96.4%

22.2%/100.0%

70.9%/86.9%

33.3%/100.0%

61.8%/91.4%

Average

83.1%/79.4%

69.9%/91.3%

46.7%/94.9%

42.6%/95.0%

44.1%/90.5%

76.5%/90.2%

36.8%/93.4%

 
Figure 1

Polyacrylamide gel electrophoresis bands representing microsatellites derived from FL-cDNA sequences, tested on a panel of selected bamboo species to evaluate transferability and polymorphism in locus of PBM042 (above) and PBM064 (nether). M: size marker. Mb, Cp, etc.: Bamboo species abbreviations are listed in Supplementary Table 1.

Using polymorphic FL-cDNA SSR markers to estimate outcrossing rates and identify interspecific bamboo hybrids

Sexual propagation increases genetic diversity by creating progenies of different genotypes through recombination (i.e. outcrossing). This is advantageous for predominantly clonal plants such as most bamboo species, which rely mostly on vegetative regeneration interspersed with occasional flowering (Janzen 1976). The analysis of the reproductive system is therefore fundamental to elucidate primary genetic diversity and the structure of regenerating bamboo populations, and to adopt strategies for genetic improvement. Previous studies on the bamboo reproductive system based on field data and artificial pollination showed that self-compatibility is predominant in Sasa species (Nishiwaki and Konno 1990), and the selfing rate could approach 0.99 in Merostachys riedeliana (Guilherme and Ressel 2001). Outcrossing rate was estimated using SSR-based analysis as reported in S. cernua (Kitamura and Kawahara 2011).

Among the 22 polymorphic SSR markers described above, the ten most polymorphic (PIC ≥ 0.36) were used to detect polymorphisms in 50 open-pollinated half-sib seeds (year 2011) from three flowering sites in the Guangxi Province separated by at least 100 km. Polymorphism in the PBM044, PBM080 and PBM095 loci was identical in the seeds from all three flowering sites, whereas PBM084 and PBM091 featured additional alleles from Lipu, PBM069, PBM075, PBM087 and PBM091 featured additional alleles from Lingchuan, and PBM069, PBM075 and PBM084 featured additional alleles from Guanyang (Table 5). This indicated that flowering culms in different sites featured diverse SSR genotypes and produced genetically-diverse half-sib seed sources. Therefore, we used these eight polymorphic loci to estimate the outcrossing rates and other related genetic parameters for P. pubescens (Table 5). The overall estimates of tm and ts for three culms were 0.089 for both parameters, with no standard deviation. The estimates for individual culms showed small differences of 0.067 in Lipu and Lingchuan, and 0.133 in Guanyan, again for both parameters. Estimation of F is for the overall population was 0.195, indicating homozygote excess. We found that the outcrossing rate was 0.089, estimated from eight polymorphic multilocus datasets in P. pubescens, which is slight lower than the 0.148 reported in S. cernua using six multilocus SSR datasets (Kitamura and Kawahara 2011). This indicated that the reproductive system of P. pubescens predominantly involves self-fertilization with an adequate proportion of crossing to ensure genetic diversity as reported for S. cernua (Kitamura and Kawahara 2011).
Table 5

Seed number, estimated outcrossing rates and relative parameters for each of three P. pubescens flowering culms at 8 loci

Flowering site (county)

N

tm

ts

Fis

Genotype

    

PBM044

PBM069

PBM075

PBM080

PBM084

PBM087

PBM091

PBM095

Lipu

50

0.067 (0.0)

0.066 (0.0)

0.182

p

  

p

p

 

p

p

Lingchuan

50

0.067 (0.0)

0.067 (0.0)

0.173

p

p

p

p

 

p

p

p

Guanyan

50

0.133 (0.0)

0.135 (0.0)

0.231

p

p

p

p

p

  

p

Average

 

0.089 (0.0)

0.089 (0.0)

0.195

        

N the number of analyzed seeds; tm multi-locus outcrossing rate and standard error in parentheses; ts, single-locus outcrossing rate and standard error in parentheses. Fis inbreeding coefficient; p polymorphism.

The grow-out test for bamboo interspecific hybrids is time-consuming and laborious because it involves growing plants to maturity (which takes at least 5 years), assessing several anatomical, morphological and floral (long-term interval) characteristics that distinguish the hybrid. The polymorphic SSR markers could also help in the rapid and accurate identification of interspecies hybrids, as reported in poplar (Rajora and Rahman 2003) and wheat-barley (Malysheva et al. 2003). To obtain proof of principle that our novel SSR markers are suitable for hybrid characterization, we next selected several highly-transferable and polymorphic FL-cDNA SSR markers. PBM032, PMB049, PMB063 and PMB064, each with a number of species-restricted alleles, were used to test uncharacterized bamboo samples. Marker PMB063 identified the parental species in one hybrid as P. kwangsiensis and P. bambusoides, because all sequenced bands contained the (TCCA)n motif although with a variable number of repeats (Figure 2). Similarly, marker PMB064 identified the parental species B. pervariabilis and Dendrocalamus latiflorus which are distantly related to P. pubescens, with a variable number of repeats in the (GAGT)n motif (Figure 3). As previously shown using GSS-SSR markers, such high levels of transferability and polymorphism within the Bambusoideae subfamily should allow the use of FL-cDNA SSR markers to identify interspecific hybrids and their parents, both within the genus Phyllostachys (Tang et al. 2010) and in more distant taxa within subtribe of Shibataeeae (Lu et al. 2009). We have also developed several putative EST-SSR markers in B. oldhamii and have used these to identify some other sympodial bamboo interspecies hybrids (Wu et al. 2009; Dong et al. 2011). The SSR markers developed in the present study were used to identify not only interspecific hybrids from monopodial Phyllostachys but also intergeneric hybrids with sympodial rhizomes, which are distantly related to P. pubescens. Our data confirmed that microsatellites, especially SSR markers based on cDNAs and ESTs, are ideal for the identification of bamboo interspecies hybrids.
Figure 2

A, Microsatellite DNA fingerprints of P. kwangsiensis (line 1), P. bambusoides (line 3) and a presumed hybrid (line 2) at locus PBM063. B, Alignment of the nucleotide sequences of the microsatellite alleles at locus PBM014 amplified from P. kwangsiensis, P. bambusoides and two presumed hybrids. Nucleotides conserved among these sequences (relative to P. kwangsiensis) are shown by dots. The lines indicate the primer sequences used to amplify this microsatellite locus. The box highlights the microsatellite. The suffix numbers after bamboo species correspond to the DNA bands marked in part (a).

Figure 3

A, Microsatellite DNA fingerprints of Bambusa pervariabilis , Dendrocalamus latiflorus and their presumed hybrids at locus PBM064. B, Alignment of the nucleotide sequences of the microsatellite alleles at locus PBM064 amplified from B. pervariabilis, D. latiflorus and their presumed hybrids. Nucleotides conserved among these sequences (relative to B. pervariabilis) are shown by dots. The lines indicate the primer sequences used to amplify this microsatellite locus. The box highlights the microsatellite. The suffix numbers after the bamboo species correspond to the DNA bands marked in part (A).

Conclusions

Our data provide insight into the association between SSRs and TEs in FL-cDNAs from the P. pubescens transcriptome, allowing us to develop and evaluate 68 FL-cDNA SSR markers that can be used in P. pubescens and partially for many other bamboo species, to estimate the reproductive system of P. pubescens and identify several interspecific hybrids. These FL-cDNA SSR markers enrich the molecular marker resources currently available for bamboo. When a large set of polymorphic markers becomes available, we can use genome-wide association mapping in bamboo, in the absence of structured populations, to identify markers for traits of interest that can be used for marker-assisted selection in the Bambusoideae subfamily.

Methods

Full-length cDNA mining and SSR/TE detection

We obtained 10,608 FL-cDNA sequences from NCBI Entrez (http://www.ncbi.nlm.nih.gov/) on July 1, 2010. These cDNA sequences were assembled from five cDNA libraries constructed from breaking-out shoots, young (40-cm) shoots and young leaves from plants, and shoots and roots from germinated seeds (Peng et al. 2010). We used EST Trimmer (http://pgrc.ipk-gatersleben.de/misa/download/est_trimmer.pl) to remove poly(A/T) runs from the 5′ and 3′ ends until there were no occurrences of (T)5 or (A)5 within a 50-bp range. Redundant sequences were eliminated and overlapping sequences were spliced together using CAP3 (http://seq.cs.iastate.edu/cap3.html) (Huang and Madan 1999).

After pre-treatment, we used MISA (http://pgrc.ipk-gatersleben.de/misa/misa.html) to screen for SSRs including mononucleotide repeats ≥10 bp in length, dinucleotide to hexanucleotide repeats with ≥6 repeat units, and interrupted composite SSRs with ≤100 bp of intervening DNA. Putative annotations were assigned to non-redundant ESTs containing SSRs using BLAST against the Moso Bamboo cDNA Database (http://202.127.18.228/mbcd/) and the Gramene Ontologies Database (http://archive.gramene.org/plant_ontology/). TEs were identified using RepeatMasker and RepeatProteinMask (http://www.repeatmasker.org) based on similar elements present in the rice genome, and SSRs within TEs were screened using MISA with the same parameters as above. Additional file 1: Figure S1 provides a flow chart for the data mining and marker development process.

Plant material and DNA extraction

We used P. pubescens samples collected from the Anji Bamboo Germplasm Garden, Anji, Zhejiang Province, to identify and characterize putative FL-cDNA SSR markers. The polymorphism of these SSR markers was evaluated using 50 seedlings germinated from an open-pollinated seedlots (mixed seed sources, mainly from different flowering sites in the counties of Lipu, Lingchuan and Guanyang, Guangxi Province in the year 2010). Another 50 seedlings were germinated from open-pollinated half-sib seeds (year 2011) from three flowering culms in the same three counties (>100 km between sites) and were used to estimate the P. pubescens outcrossing rate. We obtained 41 representative bamboo species from 38 genera within six subtribes mainly found in China to test the transferability and polymorphism of the FL-cDNA SSR markers (Additional file 2: Table S1). We obtained three Phyllostachys interspecific hybrids from Jiangxi Province, China, and two intergeneric hybrids from Yoshinaka Bamboo Germplasm Garden, Fukuoka, Japan, for the hybrid identification tests. Genomic DNA was extracted from young leaves using the hexadecyltrimethylammonium bromide (CTAB) method (Doyle and Doyle 1987), with some modifications.

Amplification and sequencing of SSR loci

Primer pairs designed according to the available cDNA sequences were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. P. pubescens DNA was amplified in 20-μl reactions comprising 50–100 ng of template DNA, 0.2 μM of each primer, 200 μM of each dNTP and 1 unit of Taq DNA polymerase with 1× PCR universal buffer (10 μM Tris–HCl, pH 8.3 at 25°C; 50 μM KCl), and 1.5 μM MgCl2 (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd). The reaction was heated to 95°C for 5 min using an ABI PE9700 thermocycler, followed by 30 cycles of 1 min denaturation at 95°C, 1 min annealing at 46–59°C depending on the primer pair (Table 3), and 2 min extension at 72°C, followed by a final hold at 72°C for 5 min. Amplified microsatellite loci were tested in 41 diverse species in six tribes of the Bambusoideae subfamily (Table 4) and interspecific hybrids (Figures 2 and 3). The annealing temperature was lowered by 2–5°C according to the evolutionary distance between species based on molecular markers (Das et al. 2008) and nuclear and chloroplast sequences (Yang et al. 2008), as suggested by Rossetto (2001). PCR products were separated on 6% polyacrylamide denaturing gels, and marker bands were revealed by silver staining as described by Panaud et al. (1996). Specific bands were excised directly from the silver staining polyacrylamide gel, purified using the EZ-10 Spin Column DNA Gel Extraction Kit (Biobasic Inc.) and ligated into the pUC18 vector (TaKaRa, Japan). Three positive clones for each bamboo species were selected for sequencing using BigDye terminator V3.1 in a cycle sequencing protocol according to the manufacturer’s specifications (PE Applied Biosystems, ABI PRISM 3100-Avant Automatic DNA Sequencer). Vector sequences were removed then edited using Vector NTI software (version 10.0, Invitrogen Co., USA). Sequences were deposited in NCBI GenBank (accession nos GU644371–GU644438).

Data analysis

The polymorphism information content (PIC) (Botstein et al. 1980) of our SSR markers was determined using Powermarker v3.25 (Liu and Muse 2005). All 68 selected primer pairs were used to amplify template DNA from 41 bamboo species covering 35 genera in six subtribes (Additional file 2: Table S1) and the statistical methods of Nayak and Rout (2005) and Sharma et al. (2009) were used to calculate the cross-taxon transferability and polymorphism (Additional file 3: Table S2), in which polymorphism is calculated only from the loci that were successfully transferred across taxa (Rossetto 2001). Single locus and multilocus outcrossing rates and relative parameters were analyzed separately under the mixed mating model of Ritland & Jain (1981) and Ritland (2002), implemented using MLTR v3.4 (Ritland 1996).

Declarations

Acknowledgements

This work was financially supported by grants from the “973” Program (2012CB723008), National Natural Science Foundation of China (31170623), and Agricultural Projects of Zhejiang Province (2010C12011, 2012C12908-2).

Authors’ Affiliations

(1)
The Nurturing Station for the State Key Laboratory of Subtropical Silviculture, Zhejiang A & F University
(2)
Laboratory of Forest Ecosystem Studies, The University of Tokyo

References

  1. Aggarwal RK, Hendre PS, Varshney RK, Bhat PR, Krishnakumar V, Singh L: Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor Appl Genet 2007, 114(2):359-372. 10.1007/s00122-006-0440-xView ArticleGoogle Scholar
  2. Akagi H, Yokozeki Y, Inagaki A, Mori K, Fujimura T: Micron, a microsatellite-targeting transposable element in the rice genome. Mol Genet Genomics 2001, 266: 471-480. 10.1007/s004380100563View ArticleGoogle Scholar
  3. Botstein D, White RL, Skolnick M, Davis RW: Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 1980, 32: 314-331.Google Scholar
  4. Cordeiro GM, Casu R, McIntyre CL, Manners JM, Henry RJ: Microsatellite markers from sugarcane ( Saccharum spp.) ESTs cross-transferable to erianthus and sorghum. Plant Sci 2001, 160(6):1115-1123. 10.1016/S0168-9452(01)00365-XView ArticleGoogle Scholar
  5. Das M, Bhattacharya S, Singh P, Filgueiras TS, Pal A: Bamboo taxonomy and diversity in the era of molecular markers. In Advances in Botanical Research. Edited by: Jean-Claude K, Michel D. San Diego, CA 92101-4495, USA: Academic Press; 2008:225-268.Google Scholar
  6. Dong WJ, Wu MD, Lin Y, Tang DQ: Evaluation of 15 caespitose bamboo EST-SSR markers for cross-species/genera transferability and ability to identify interspecies hybrids. Plant Breed 2011, 130: 596-600. 10.1111/j.1439-0523.2011.01860.xView ArticleGoogle Scholar
  7. Doyle JJ, Doyle JL: A rapid isolation procedure for small quantities of fresh leaf materials. Phytochem Bull 1987, 19: 11-15.Google Scholar
  8. Feng S, Li W, Huang H, Wang J, Wu Y: Development, characterization and cross-species/genera transferability of EST-SSR markers for rubber tree ( Hevea brasiliensis ). Mol Breed 2009, 23(1):85-97. 10.1007/s11032-008-9216-0View ArticleGoogle Scholar
  9. Fu J: Chinese Moso Bamboo: Its importance. Bamboo 2001, 22(5):5-7.Google Scholar
  10. Gui Y, Sheng W, Quan L, Zhou C, Long S, Zheng H, Jin L, Zhang X, Ma N, Fan L: Genome size and sequence composition of moso bamboo: A comparative study. Sci China Series C: Life Sci 2007, 50(5):700-705.View ArticleGoogle Scholar
  11. Guilherme FAG, Ressel K: Biologia floral e sistema de reprodução de Merostachys riedeliana (Poaceae: Bambusoideae). Revta brasil Bot 2001(in Spanish with English abstract), 24: 205-211. (in Spanish with English abstract) 10.1590/S0100-84042001000200011View ArticleGoogle Scholar
  12. Higa JK, Liang Z, Williams PG, Panee J: Phyllostachys edulis compounds inhibit palmitic acid-induced monocyte chemoattractant protein 1 (MCP-1) production. PLoS One 2012, 7(9):e45082. 10.1371/journal.pone.0045082View ArticleGoogle Scholar
  13. Huang X, Madan A: CAP3: A DNA sequence assembly program. Genome Res 1999, 9: 868-877. 10.1101/gr.9.9.868View ArticleGoogle Scholar
  14. Jakupiak JP, Wells RD: Genetic instabilities in (CTG.CAG) repeats occur by recombination. J Biol Chem 1999, 274: 23468-23479. 10.1074/jbc.274.33.23468View ArticleGoogle Scholar
  15. Janzen DH: Why bamboos wait so long to flower. Ann Rev Eco Syst 1976, 7: 347-391. 10.1146/annurev.es.07.110176.002023View ArticleGoogle Scholar
  16. Kitamura K, Kawahara T: Clonal identification by microsatellite loci in sporadic flowering of a dwarf bamboo species, Sasa cernua . J Plant Res 2009, 122(3):299-304. 10.1007/s10265-009-0220-1View ArticleGoogle Scholar
  17. Kitamura K, Kawahara T: Estimation of outcrossing rates at small-scale flowering sites of the dwarf bamboo species, Sasa cernua . J Plant Res 2011, 124: 683-688. 10.1007/s10265-010-0398-2View ArticleGoogle Scholar
  18. Kofler R, Bartos J, Gong L, Stift G, Sucha′nkova P, Suchankova P, Simkova H, Berenyi M, Burg K, Dolezel J, Lelley T: Development of microsatellite markers specific for the short arm of rye ( Secale cereale L.) chromosome 1. Theor Appl Genet 2008, 117(6):915-926. 10.1007/s00122-008-0831-2View ArticleGoogle Scholar
  19. Li XL, Liu S, Shong WQ, Chen RY, Wang WZ: Chromosome numbers of forty species of scattered bamboo. Acta Phytotax Sinica 1999(in Chinese with English abstract), 37(6):541-544. (in Chinese with English abstract)Google Scholar
  20. Li XL, Lin RS, Fen XL, Qi ZX, Song WQ, Chen RY: Chromosome numbers of ninety-four species of caespitose bamboo. Acta Phytotax Sinica 2001(in Chinese with English abstract), 39(5):433-442. (in Chinese with English abstract)Google Scholar
  21. Liang X, Chen X, Hong Y, Liu H, Zhou G, Li S, Guo B: Utility of EST-derived SSR in cultivated peanut ( Arachis hypogaea L.) and Arachis wild species. BMC Plant Biol 2009, 9: 35. 10.1186/1471-2229-9-35View ArticleGoogle Scholar
  22. Lin XC, Ruan XS, Lou YF, Guo XQ, Fang W: Genetic similarity among cultivars of Phyllostachys pubescens . Plant Syst Evol 2009, 277: 67-73. 10.1007/s00606-008-0104-1View ArticleGoogle Scholar
  23. Liu KJ, Muse SV: PowerMarker: An integrated analysis environment for genetic marker date. Bioinformatics 2005, 21(9):2128-2212. 10.1093/bioinformatics/bti282View ArticleGoogle Scholar
  24. Lu HJ, Fellers JP, Friesen TL, Meinhardt SW, Faris JD: Genomic analysis and marker development for the Tsn1 locus in wheat using bin-mapped ESTs and flanking BAC contigs. Theor Appl Genet 2006, 112(6):1132-1142. 10.1007/s00122-006-0215-4View ArticleGoogle Scholar
  25. Lu JJ, Yoshinaga K, Fang W, Tang DQ: Identification of the bamboo hybrids by SSR markers. Sci Silv Sin 2009(in Chinese with English abstract), 45(3):29-34. (in Chinese with English abstract)Google Scholar
  26. Malysheva L, Sjakste T, Matzk F, Roder M, Ganal M: Molecular cytogenetic analysis of wheat-barley hybrids using genomic in situ hybridization and barley microsatellite markers. Genome 2003, 46: 314-322. 10.1139/g02-117View ArticleGoogle Scholar
  27. Miyazaki Y, Ohnishi N, Hirayama K, Nagata J: Development and characterization of polymorphic microsatellite DNA markers for Sasa senanensis (Poaceae: Bambuseae). Conserv Genet 2009, 10: 585-587. 10.1007/s10592-008-9575-4View ArticleGoogle Scholar
  28. Monden Y, Naito K, Okumoto Y, Saito H, Oki N, Tsukiyama T, Ideta O, Nakazaki T, Wessler SR, Tanisaka T: High potential of a transposon mPing as a marker system in japonica x japonica cross in rice. DNA Res 2009, 16(2):131-140. 10.1093/dnares/dsp004View ArticleGoogle Scholar
  29. Nayak S, Rout GR: Isolation and characterization of microsatellites in Bambusa arundinacea and cross species amplification in other bamboos. Plant Breed 2005, 124: 559-602.View ArticleGoogle Scholar
  30. Nishiwaki A, Konno Y: Pollination system in two dwarf bamboo species. Bamboo J 1990, 8: 17-20.Google Scholar
  31. Panaud O, Chen X, McCouch SR: Development of microsatellite markers and characterization of simple sequence length polymorphism (SSLP) in rice ( Oryza sativa L.). Mol Gen Genet 1996, 252: 597-607.Google Scholar
  32. Peng Z, Lu T, Li L, Liu X, Gao Z, Hu T, Yang X, Feng Q, Guan J, Weng Q, Fan D, Zhu C, Lu Y, Han B, Jiang Z: Genome wide characterization of the biggest grass, bamboo, based on 10,608 putative full-length cDNA sequences. BMC Plant Biol 2010, 10: 116. 10.1186/1471-2229-10-116View ArticleGoogle Scholar
  33. Rajora P, Rahman H: Microsatellite DNA and RAPD fingerprinting, identification and genetic relationships of hybrid poplar ( Populus x canadensis ) cultivars. Theor Appl Genet 2003, 106: 470-477.Google Scholar
  34. Richard GF, Kerrest A, Dujon B: Comparative genomics and molecular dynamics of DNA repeats in eukaryotes. Micr Mol Bio Rev 2008, 72: 686-727. 10.1128/MMBR.00011-08View ArticleGoogle Scholar
  35. Richards RI, Sutherland GR: Simple repeat DNA is not replicated simply. Nature Genet 1994, 6: 114-116. 10.1038/ng0294-114View ArticleGoogle Scholar
  36. Ritland K: Multilocus mating system program – MLTR. 1996. Available free of charge at http://genetics.forestry.ubc.ca/ritland/programs.htmlGoogle Scholar
  37. Ritland K: Extensions of models for the estimation of mating systems using n independent loci. Heredity 2002, 88: 221-228. 10.1038/sj.hdy.6800029View ArticleGoogle Scholar
  38. Ritland K, Jain SK: A model for the estimation of outcrossing rate and gene frequencies using n independent loci. Heredity 1981, 47: 35-52. 10.1038/hdy.1981.57View ArticleGoogle Scholar
  39. Rossetto M: Sourcing of SSR markers from related plant species. In Plant genotyping---the DNA fingerprinting of plant. Edited by: Henry RJ. Wallingford, Oxon OX10 8DE, UK: CABI Publishing; 2001:211-224.View ArticleGoogle Scholar
  40. Rossi M, Araujo PG, Paulet F, Garsmeur O, Dias VM, Chen H, Van Sluys MA, D′Hont A: Genomic distribution and characterization of EST-derived resistance gene analogs (RGAs) in sugarcane. Mol Genet Genomics 2003, 269(3):406-419. 10.1007/s00438-003-0849-8View ArticleGoogle Scholar
  41. Scherer S: A short guide to the human genome. Cold Spring Harbor University Press, Cold Spring, NY; 2008.Google Scholar
  42. Sharma RK, Gupta P, Sharma V, Sood A, Mohapatra T, Ahuja PS: Evaluation of rice and sugarcane SSR markers for phylogenetic and genetic diversity analyses in bamboo. Genome 2008, 51(2):91-103. 10.1139/G07-101View ArticleGoogle Scholar
  43. Sharma V, Bhardwaj P, Kumar R, Sharma RK, Sood A, Ahuja PS: Identification and cross-species amplification of EST derived SSR markers in different bamboo. Conserv Genet 2009, 10: 721-724. 10.1007/s10592-008-9630-1View ArticleGoogle Scholar
  44. Squirrell J, Hollingsworth PM, Woodhead M, Russell J, Lowe AJ, Gibby M, Powell W: How much effort is required to isolate nuclear microsatellites from plants? Mol Ecol 2003, 12(6):1339-1348. 10.1046/j.1365-294X.2003.01825.xView ArticleGoogle Scholar
  45. Tang DQ: Genomic sequencing and its application for biological and evolutional research in bamboo. Bamboo J 2009, 26: 1-10.Google Scholar
  46. Tang DQ, Lu JJ, Fang W, Zhang S, Zhou MB: Development, characterization and utilization of GenBank microsatellite markers in Phyllostachys pubescens and related species. Mol Breed 2010, 25: 299-311. 10.1007/s11032-009-9333-4View ArticleGoogle Scholar
  47. Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, McCouch SR: Computational and experimental analysis of microsatellites in rice ( Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential. Genome Res 2001, 11: 1441-1452. 10.1101/gr.184001View ArticleGoogle Scholar
  48. Tero N, Neumeier H, Gudavalli R, Schlo¨tterer C: Silene tatarica microsatellites are frequently located in repetitive DNA. J Evol Biol 2006, 19(5):1612-1619. 10.1111/j.1420-9101.2006.01118.xView ArticleGoogle Scholar
  49. Thiel T, Michalek W, Varshney RK, Graner A: Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley ( Hordeum vulgare L.). Theor Appl Genet 2003, 106: 411-422.Google Scholar
  50. Tomilin NV: Regulation of mammalian gene expression by retroelements and non-coding tandem repeats. Bioessays 2008, 30: 338-348. 10.1002/bies.20741View ArticleGoogle Scholar
  51. Watanabe M, Ueda K, Manabe I, Akai T: Flowering, seeding, germination and flowering periodicity of Phyllostachys pubescens . J Jpn For Soc 1982, 64: 107-111.Google Scholar
  52. Wei F, Wing RA, Wise RP: Genome dynamics and evolution of the Mla (powdery mildew) resistance locus in barley. Plant Cell 2002, 14: 1903-1917. 10.1105/tpc.002238View ArticleGoogle Scholar
  53. Wu M, Dong W, Tang DQ: Identification of four caespitose hybrid bamboos by using SSR markers. Mol Plant Breed 2009(in Chinese with English abstract), 7(5):959-965. (in Chinese with English abstract)Google Scholar
  54. Yang HQ, Yang JB, Gao J, Yang YM, Peng S, Li DZ: A molecular phylogenetic and fruit evolutionary analysis of the major groups of the paleotropical woody bamboos (Gramineae: Bambusoideae) based on nuclear ITS, GBSSI gene and plastid trnL -F DNA sequences. Mol Phylogenet Evol 2008, 48(3):809-824. 10.1016/j.ympev.2008.06.001View ArticleGoogle Scholar
  55. Yu JK, Dake TM, Singh S, Benscher D, Li W, Gill B, Sorrells ME: Development and mapping of EST-derived simple sequence repeat markers for hexaploid wheat. Genome 2004, 47(5):805-818. 10.1139/g04-057View ArticleGoogle Scholar
  56. Zhang LY, Bernard M, Leroy P, Feuillet C, Sourdille P: High transferability of bread wheat EST-derived SSRs to other cereals. Theor Appl Genet 2005, 111(4):677-687. 10.1007/s00122-005-2041-5View ArticleGoogle Scholar
  57. Zhong H, Zhou MB, Xu CM, Tang DQ: Diversity and evolution of Pong -like elements in Bambusoideae subfamily. Biochem Syst Ecol 2010, 38: 750-758. 10.1016/j.bse.2010.06.010View ArticleGoogle Scholar
  58. Zhou MB, Lu JJ, Zhong H, Liu XM, Tang DQ: Distribution and diversity of PIF -like transposable elements in the Bambusoideae subfamily. Plant Sci 2010, 179: 257-266. 10.1016/j.plantsci.2010.05.012View ArticleGoogle Scholar
  59. Zhou MB, Lu JJ, Zhong H, Tang KX, Tang DQ: Distribution and polymorphism of mariner -like elements in the Bambusoideae subfamily. Plant Syst Evol 2010, 289: 1-11. 10.1007/s00606-010-0323-0View ArticleGoogle Scholar
  60. Zhou MB, Zhong H, Zhang QH, Tang KX, Tang DQ: Diversity and evolution of Ty1- copia retroelements in representative tribes of Bambusoideae subfamily. Genetica 2010, 138: 861-868. 10.1007/s10709-010-9469-5View ArticleGoogle Scholar

Copyright

© Lin et al.; licensee Springer. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.