Open Access

Identification of differentially methylated regions (DMRs) of neuronatin in mice

  • Yuxin Xu1,
  • Zhiquan Liu1,
  • Tiedong Wang1,
  • Xianju Chen1,
  • Jichao Deng1,
  • Mao Chen1 and
  • Zhanjun Li1Email author
Contributed equally
SpringerPlus20165:2018

https://doi.org/10.1186/s40064-016-3721-0

Received: 18 April 2016

Accepted: 21 November 2016

Published: 28 November 2016

Abstract

Background

Neuronatin (NNAT) is a paternal-inherited imprinted gene, first discovered in the rat neonatal brain, where it plays vital roles for neuronal growth, brain development, and metabolic regulation. The maternal imprint of NNAT has been identified in mice; however, the differentially methylated regions (DMRs) involved in the monoallelic expression of NNAT have not yet been investigated.

Results

In this study, we confirmed expression of two isoforms of the NNAT (α and β) in the mice brain via quantitative RT-PCR. Additionally, the methylation profile of the CpG island located in the NNAT gene locus was determined in the mice liver, brain, sperm, and the MII oocyte via bisulfite sequencing PCR.

Conclusion

In summary, we provide the first evidence for tissue- and gamete-specific methylation patterns of CpG3 that are located on exon 1, to be putative DMR of NNAT in mice.

Keywords

NNAT DMRMiceIsoform

Background

Genomic imprinting leads to unequal expression of paternal and maternal alleles in offspring, which is essential for normal embryogenesis, fetal growth, and functional postnatal behavior (Surani 1998; Li et al. 1999; Das et al. 2013). The differentially methylated regions (DMRs) are established during gametogenesis and regulate the parent-specific expression of imprinted genes. DMRs with allele specific methylation have also been used in cancer diagnosis (Ushijima 2005; Bonin et al. 2016). Although 125 imprinted genes have been identified in mice to date (according to the Gene imprint database; http://www.geneimprint.com/), very little has been published about the DMRs of those imprinted genes (Gu et al. 2014).

NNAT is a highly conserved imprinted gene among humans, mice, cattle, and pigs, containing two alternatively spliced transcripts (α and β) (Cheng et al. 2007; Schulz et al. 2009). Previous studies have revealed the parental-specific expression of NNAT to be associated with the methylation status of the CpG island located in the NNAT promoter sequence of pigs (Chen et al. 2014; Gu et al. 2014) and rabbits (Duan et al. 2015). A second intronic DNA sequence within the mouse NNAT with a length of 250 bp was defined as putative DMR and was revealed to act as a transcriptional activator in Drosophila (Sowpati et al. 2008). In addition, the hyper methylation of human NNAT frequently occurs in pediatric acute leukemia and Wilms Tumors (Kuerbitz et al. 2002; Hubertus et al. 2013).

All of these previously published findings suggest that there is no definite DMR of NNAT in mice. With this background, we sought to identify the DMRs of mice NNAT via quantitative real-time PCR (q-PCR) and bisulfite sequencing PCR (BSP) analyses.

Results and discussion

In this study, we proposed a model of two NNAT isoforms (α and β) using GenBank and Ensembl databases. Furthermore, putative DMRs of NNAT (CpG 1 and CpG 2, CpG 3, CpG I2) were identified via comparative sequencing analysis and methyprimer (Fig. 1a). The results of q-PCR and RT-PCR demonstrated high expression of both of the transcripts (α and β) in the brain of mice, but not in their liver, which is consistent with the UniGene database (Fig. 1b, c). Previous studies have found two transcripts of NNAT that are widely expressed in most of tissues, including in livers and kidneys of cattle (both fetal and adult) and in 2-month-old pigs (Zaitoun and Khatib 2006; Cheng et al. 2007), suggesting different NNAT expression profiles between species.
Fig. 1

Gene structure and expression analysis of NNAT in mice. a Structure of the mice NNAT locus. NNAT features two alternatively spliced transcripts (α- and β-form). Protein coding regions are shown as black, filled boxes. Circles indicate CpG islands located in NNAT and analyzed via BSP. Q: Primers for q-PCR; RT: Primers for RT-PCR; b RT-PCR was used to detect the expression of two alternatively spliced isoforms in both brain and liver. c Gene expression of NNAT in brain and liver determined via q-PCR. Data are shown as Mean ± SEM (n = 6), *p < 0.05, **p < 0.01, ***p < 0.001

To identify the DMR of mice NNAT, methylation profiles of CpG 1, CpG 2, CpG 3, and CpG I2 were determined in both the brain and the liver using BSP. The results revealed hypermethylation of CpG1 (Fig. 2a vs. e), CpG2 (Fig. 2b vs. f), and CpG I2 (Fig. 2d vs. h) in both brain and liver. However, we found tissue-specific methylation patterns of CpG3 in the brain (29.33%) and liver (66%) (Fig. 2c vs. g). These results point towards the methylation status of CpG3 accounting for the expression difference of NNAT in liver vs. brain. In addition, tissue-specific methylation patterns revealed CpG3 (located on exon 1) to be a putative DMR of the NNAT in mice (Fig. 2c).
Fig. 2

DMR identification of NNAT in mice. The methylation status was analyzed via BSP: The results are depicted for CpG 1 in brain a and liver e, for CpG 2 in brain b and liver f, for CpG 3 brain (c) and liver (g), and for CpG 3 in brain (d) and liver (h). Open and closed circles indicate unmethylated and methylated CpG sites, respectively. Numbers in parentheses represent the methylated CpG sites relative to all counted CpG sites

Generally, DNA methylation patterns of imprinted genes were established in both sperm and oocyte, which were reprogrammed subsequent after fertilization (Seisenberger et al. 2013). To identify the gamete-specific methylation pattern of CpG3 in mice NNAT, the DNA methylation profile of CpG3 in sperm and oocyte was determined via BSP. The results reveal hypomethylation in sperm (10%) and hypermethylation in MII oocytes (90%) (Fig. 3). In summary, the gamete-specific methylation patterns suggest that the imprinting marks of NNAT are established by a sex-specific mechanism, confirming CpG3 as the DMR of NNAT.
Fig. 3

Gamete-specific methylation status of CpG 3. The methylation status of CpG 3 was analyzed via BSP for MII oocyte (a) and sperm (b). Open and closed circles indicate unmethylated and methylated CpG sites, respectively. Numbers in parentheses represent the methylated CpG sites relative to all counted CpG sites

Conclusions

Here, we studied the expression patterns of two isoforms of mice NNAT (α and β), and identified the CpG3 of mice NNAT (located on exon 1) as putative DMR.The data revealed hypermethylation of exon 1 to be associated with the silencing of mice NNAT, suggesting the NNAT gene transcriptional status to be correlated with the methylation status of exon 1, while being independent of both intron and 5′ UTR.

Methods

Tissue samples

The brain and liver were collected from two-month old ICR mice and immediately stored in liquid nitrogen until further use. Spermatozoa and MII oocytes were harvested using previously published protocols (Chen et al. 2014).

RT-PCR and quantitative real-time PCR (q-PCR)

Total RNA from liver and brain (n = 5) was isolated with TRNzol-A+ reagent (TIANGEN, Beijing, China) according to manufacturer’s instructions. The cDNA was synthesized with DNAse I (Fermentas, Shanghai, China) treated total RNA via the BioRTcDNA First Stand Synthesis Kit (Bioer Technology, Hangzhou, China).

The BioEasy SYBR Green I Real Time PCR Kit (Bioer Technology, Hangzhou, China) was used to perform q-PCR, using the BIO-RAD Iq5 Multicolor Real-Time PCR Detection System. The reaction conditions were as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s for DNA denaturation, 60 °C for 15 s for primer annealing, and 72 °C for 30 s for extension. Relative gene expression normalized to β-actin was determined via the 2−ΔΔCT formula. All experiments on gene expression were performed in triplicate. The gene expression data was presented as mean ± SEM. Primers used for q-PCR and RT-PCR are listed in Table 1.
Table 1

Primers for q-PCR and RT-PCR

Gene

Primer sequence (5′ → 3′)

Tann (°C)

Length (bp)

NNAT–RT

F:GCTCATCATCGGCTGGTACA

60

343

R:CTTGGCAAGTGCTCCTCTGA

262

β-actin-RT

F:ATATCGCTGCGCTGGTCGTC

60

517

R:AGGATGGCGTGAGGGAGAGC

NNAT-q

F:GTCCCCTGTGTTCCCTCGTC

60

81

R:TGTCGGTGCTGCTTTTCTGG

Actin-q

F:GGCACCACACYTTCTACAATG

60

133

R:GGGGTGTTGAAGGTCTCAAAC

T ann the annealing temperature, RT the primers for RT-PCR, Q the primers for q-PCR

Bisulfite sequencing PCR

Bisulfite sequencing PCR (BSP) was performed to determine methylation of NNAT CpG islands. The CpGenome TM Turbo Bisulfite Modification Kit (Millipore, Jaffrey, NH, USA) was used for bisulfate treatment of genomic DNA of both liver and brain according to the manufacturer’s instructions. Bisulfite-treatment of the DNA of sperms (n = 1 × 103) and matured oocytes (n = 100) was done according to the instructions of the EZ DNA Methylation-Direct™ Kit (Zymo Research,CA). Nested PCR was used to amplify CpG islands, followed by T-vector cloning (positive clones, n = 10) and subsequent sequencing analysis. The BSP primers are listed in Table 2.
Table 2

Primers for BSP

Gene

Primer sequence (5′ → 3′)

Tann (°C)

Length (bp)

CpG1-BSP

O-F:TTTTGTGTTTTAGTTGTATAGCGAA

55

504

O-R:AATACAAACCTCTTAATTCGACACA

I-F: TAGAGGTTCGTATTTGTTTCGTAG

55

275

I-R:TTTTTCTACATTCCTACTAATCCGT

CpG2-BSP

O-F:GAGCGGGAATTAATAGTTAGAAAAG

55

526

O-R:ACTAATCTCGAAATCCGCTACTAAA

I-F:GTATGTAGAATTTGTAGGTTTGGG

54

282

I-R:CTCTTACCACCTAAATACGCATAC

CpG3-BSP

O-F:GGTAGAGTAGAATTTTTTGGA

58

590

O-R:CACCCCTAAATCTTTATTCCC

I-F:TTTAGGTGGTAAGAGGGTATTTAAGGTA

60

211

I-R:AATACATACTCACCTACAACA

I2-BSP

O-F:TTTGGAATGTTGTATTTATTGGGTAGGA

55

558

O-R:CCCCTCACTAACCTTAACAAATACTCCTC

I-F:TAGTTGTTTTGATTGGTGGATAAGT

56

266

I-R:AACTCGCTACCTACGCTCCC

T ann the annealing temperature, O outside primers of the BSP, I inside primers of the BSP

Statistical analysis

Data were analyzed using student’s t-tests via SPSS 22.0 software (SPSS Inc., Chicago, IL, USA) and a p < 0.05 was considered as statistically significant. DNAman and online software tools Methprimer (http://www.urogene.org/methprimer/) and Bio Analyzer (http://biq-analyzer.bioinf.mpi-inf.mpg.de/tools/MethlationDiagrams/index.php) were used for the methylation analysis.

Notes

Abbreviations

NNAT

neuronatin

PCR: 

polymerase chain reaction

qPCR: 

quantitative real-time PCR

BSP: 

bisulfite sequencing PCR

DMR: 

differentially methylated region

RT-PCR: 

reverse transcription PCR

Declarations

Authors’ contributions

YX, TW and ZL conceived, designed and performed the experiments and wrote the manuscript. XC and JD collected the samples. MC performed the statistical analysis. ZL provided guidance. All authors read and approved the final manuscript.

Acknowledgements

We thank Peiran Hu, Xue Chen and Tingting Yu at the Embryo Engineering Center for their critical technical assistance.

Competing interests

The authors declare that they have no competing interests.

Ethics approval and consent to participate

All experiments about mice were carried out in accordance with the guidelines on animal care and supervised by the Animal Care Center and Use Committee of Jilin University. All experimental protocols were approved by the Ethics Committee of Jilin University.

Funding

This project was gratefully funded from the National Natural Science Foundation of China (Grant No. 31201080 and 31272394). Agricultural science and technology research of Guangdong province (2011A020102003).

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
College of Animal Science, Jilin University

References

  1. Bonin CA, Lewallen EA, Baheti S, Bradley EW, Stuart MJ, Berry DJ et al (2016) Identification of differentially methylated regions in new genes associated with knee osteoarthritis. Gene 576(1 Pt 2):312–318View ArticlePubMedGoogle Scholar
  2. Chen X, Wang T, Lv Q, Wang A, Ouyang H, Li Z (2014) DNA methylation-mediated silencing of neuronatin (NNAT) in pig parthenogenetic fetuses. Gene 552(1):204–208View ArticlePubMedGoogle Scholar
  3. Cheng H-C, Zhang F-W, Deng C-Y, Jiang C-D, Xiong Y-Z, Li F-E et al (2007) NNAT and DIRAS3 genes are paternally expressed in pigs. Genetics Selection Evolution 39(5):1–9View ArticleGoogle Scholar
  4. Das R, Lee YK, Strogantsev R, Jin S, Lim YC, Ng PY et al (2013) DNMT1 and AIM1 Imprinting in human placenta revealed through a genome-wide screen for allele-specific DNA methylation. BMC Genomics 14685 14:1View ArticleGoogle Scholar
  5. Duan F, Chen X, Yuan L, Song Y, Wang A, Lv Q et al (2015) Conservation of imprinting of Neuronatin (Nnat) in rabbits. Springerplus. 4:1View ArticleGoogle Scholar
  6. Gu T, Su X, Zhao S, Li C (2014) Methylation differences of the neuronatin gene promoter region in liver between normal and cloned pigs. Anim Genet 45(1):122–124View ArticlePubMedGoogle Scholar
  7. Hubertus J, Zitzmann F, Trippel F, Muller-Hocker J, Stehr M, von Schweinitz D et al (2013) Selective methylation of CpGs at regulatory binding sites controls NNAT expression in Wilms tumors. PLoS ONE 8(6):e67605ADSView ArticlePubMedPubMed CentralGoogle Scholar
  8. Kuerbitz SJ, Pahys J, Wilson A, Compitello N, Gray TA (2002) Hypermethylation of the imprinted NNAT locus occurs frequently in pediatric acute leukemia. Carcinogenesis 23(4):559–564View ArticlePubMedGoogle Scholar
  9. Li X, Hamano K, Qian XQ, Funauchi K, Furudate M, Minato Y (1999) Oocyte activation and parthenogenetic development of bovine oocytes following intracytoplasmic sperm injection. Zygote 7(3):233–237View ArticlePubMedGoogle Scholar
  10. Schulz R, McCole RB, Woodfine K, Wood AJ, Chahal M, Monk D et al (2009) Transcript- and tissue-specific imprinting of a tumour suppressor gene. Hum Mol Genet 18(1):118–127View ArticlePubMedGoogle Scholar
  11. Seisenberger S, Peat JR, Reik W (2013) Conceptual links between DNA methylation reprogramming in the early embryo and primordial germ cells. Curr Opinion Biol 25(3):281–288View ArticleGoogle Scholar
  12. Sowpati DT, Thiagarajan D, Sharma S, Sultana H, John R, Surani A et al (2008) An intronic DNA sequence within the mouse Neuronatin gene exhibits biochemical characteristics of an ICR and acts as a transcriptional activator in Drosophila. Mech Dev 125(11–12):963–973View ArticlePubMedGoogle Scholar
  13. Surani MA (1998) Imprinting and the initiation of gene silencing in the germ line. Cell 93(3):309–312View ArticlePubMedGoogle Scholar
  14. Ushijima T (2005) Detection and interpretation of altered methylation patterns in cancer cells. Nat Rev Cancer 5(3):223–231MathSciNetView ArticlePubMedGoogle Scholar
  15. Zaitoun I, Khatib H (2006) Assessment of genomic imprinting of SLC38A4, NNAT, NAP1L5, and H19 in cattle. BMC Genet 7(1):1View ArticleGoogle Scholar

Copyright

© The Author(s) 2016