Skip to main content

Advertisement

Table 1 Primers for q-PCR and RT-PCR

From: Identification of differentially methylated regions (DMRs) of neuronatin in mice

Gene Primer sequence (5′ → 3′) Tann (°C) Length (bp)
NNAT–RT F:GCTCATCATCGGCTGGTACA 60 343
R:CTTGGCAAGTGCTCCTCTGA 262
β-actin-RT F:ATATCGCTGCGCTGGTCGTC 60 517
R:AGGATGGCGTGAGGGAGAGC
NNAT-q F:GTCCCCTGTGTTCCCTCGTC 60 81
R:TGTCGGTGCTGCTTTTCTGG
Actin-q F:GGCACCACACYTTCTACAATG 60 133
R:GGGGTGTTGAAGGTCTCAAAC
  1. T ann the annealing temperature, RT the primers for RT-PCR, Q the primers for q-PCR