Skip to main content

Table 2 Primers for BSP

From: Identification of differentially methylated regions (DMRs) of neuronatin in mice

Gene Primer sequence (5′ → 3′) Tann (°C) Length (bp)
CpG1-BSP O-F:TTTTGTGTTTTAGTTGTATAGCGAA 55 504
O-R:AATACAAACCTCTTAATTCGACACA
I-F: TAGAGGTTCGTATTTGTTTCGTAG 55 275
I-R:TTTTTCTACATTCCTACTAATCCGT
CpG2-BSP O-F:GAGCGGGAATTAATAGTTAGAAAAG 55 526
O-R:ACTAATCTCGAAATCCGCTACTAAA
I-F:GTATGTAGAATTTGTAGGTTTGGG 54 282
I-R:CTCTTACCACCTAAATACGCATAC
CpG3-BSP O-F:GGTAGAGTAGAATTTTTTGGA 58 590
O-R:CACCCCTAAATCTTTATTCCC
I-F:TTTAGGTGGTAAGAGGGTATTTAAGGTA 60 211
I-R:AATACATACTCACCTACAACA
I2-BSP O-F:TTTGGAATGTTGTATTTATTGGGTAGGA 55 558
O-R:CCCCTCACTAACCTTAACAAATACTCCTC
I-F:TAGTTGTTTTGATTGGTGGATAAGT 56 266
I-R:AACTCGCTACCTACGCTCCC
  1. T ann the annealing temperature, O outside primers of the BSP, I inside primers of the BSP