Open Access

Complete plastid genome of Eriobotrya japonica (Thunb.) Lindl and comparative analysis in Rosaceae

  • Liqun Shen1,
  • Qijie Guan1,
  • Awais Amin1,
  • Wei Zhu1,
  • Mengzhu Li1,
  • Ximin Li2,
  • Lin Zhang1 and
  • Jingkui Tian1Email author
SpringerPlus20165:2036

https://doi.org/10.1186/s40064-016-3702-3

Received: 21 May 2016

Accepted: 18 November 2016

Published: 29 November 2016

Abstract

Eriobotrya japonica (Thunb.) Lindl (loquat) is an evergreen Rosaceae fruit tree widely distributed in subtropical regions. Its leaves are considered as traditional Chinese medicine and are of high medical value especially for cough and emesis. Thus, we sequenced the complete plastid genome of E. japonica to better utilize this important species. The complete plastid genome of E. japonica is 159,137 bp in length, which contains a typical quadripartite structure with a pair of inverted repeats (IR, 26,326 bp) separated by large (LSC, 89,202 bp) and small (SSC, 19,283 bp) single-copy regions. The E. japonica plastid genome encodes 112 unique genes which consist of 78 protein-coding genes, 30 tRNA genes and 4 rRNA genes. Gene structure and content of E. japonica plastid genome are quite conserved and show similarity among Rosaceous species. Five large indels are unique to E. japonica in comparison with Pyrus pyrifolia and Prunus persica, which could be utilized as molecular markers. A total of 72 simple sequence repeats (SSRs) were detected and most of them are mononucleotide repeats composed of A or T, indicating a strong A or T bias for base composition. The Ka and Ks ratios of most genes are lower than 1, which suggests that most genes are under purifying selection. The phylogenetic analysis described the evolutionary relationship within Rosaceae and fully supported a close relationship between E. japonica and P. pyrifolia.

Keywords

Eriobotrya LoquatChloroplast genomeRosaceaeGene evolution

Background

Chloroplast (cp), which is derived from free-living cyanobacteria through endosymbiosis (Keeling 2004), plays an essential role in photosynthesis and many biosynthetic activities such as biosynthesis of certain amino acids and fatty acids. Chloroplast contains its own genome which displays a typical quadripartite structure with two copies of inverted repeats separated by large single copy and small single copy (Nguyen et al. 2015). In general, plastomes of angiosperms range from 120 to 170 kb and mostly contain 100–120 different genes. The chloroplast genome is usually recognized as highly conserved in gene structure and content, especially in closely related groups. However, IR loss or expansion/contraction which contributes to the variation in genome size can be easily found in some clades. Gymnosperms such as Taxus chinensis var. mairei (Zhang et al. 2014b) and Cephalotaxus oliveri (Yi et al. 2013) were identified to lose one copy of IR, leading to a decrease in genome size. Ma et al. (2013) found a significant IR expansion in Mahonia bealei in which 15 genes had an additional duplication in IR regions. Slight shift of IR/SC boundaries appears more commonly and may cause small changes in the extent of IR (Goulding et al. 1996). Consequently, structure differences of IR have been considered as important features to provide insights into gene evolution among species.

The plastid genome is good resource to provide sufficient information for phylogenetic analysis and DNA barcoding. Thanks to rapid development of next-generation sequencing, the number of whole plastid genome available is increasing constantly, which makes large-scale phylogenetic research based on plastid genomes possible (Jansen et al. 2007). In addition, comparative analysis among species can provide large amount of genetic information such as insertion or deletion (indel) and nucleotide substitutions, which can be utilized for diversity analysis and molecular markers (Cho et al. 2015).

There are over 100 genera containing approximately 3000 species in Rosaceae which is medium-sized, but of high economic importance (Potter et al. 2007). As the third most important economical family in temperate regions, many edible fruits like apple (Malus), loquat (Eriobotrya), pear (Pyrus) and peach (Prunus) as well as ornamental plants such as rose (Rosa) are included. However, till now, phylogenetic relationships within Rosaceae family have been uncertain. Traditional morphological studies divided Rosaceae into 4 subfamilies including Spiraeoideae, Maloideae, Rosoideae and Prunoideae according to the type of fruit (Kalkman 1988). Molecular studies however, put forward different opinions that Rosaceae was divided into three subfamilies: Dryadoideae, Rosoideae and Spiraeoideae (Potter et al. 2007). As the plastid genome can offer useful phylogenetic information, several plastomes of Rosaceae plants have been sequenced and reported, such as Malus domestic (http://www.rosaceae.org/projects/apple_genome), Pyrus pyriofolia (AP012207.1), Prunus persica (HQ336405) and Fragaria virginiana (NC_019602). Most of these studies focused on the comparative analysis and evolutionary studies within genera. Wang et al. (2013) reported the chloroplast genome of Prinsepia utilis and reconstructed phylogenetic relationships within Rosaceae but with low bootstrap values. So more closely related plastid genomes are needed to deal with intrafamilial classifications within Rosaceae.

Eriobotrya japonica (Thunb.) Lindl (loquat), which belongs to Rosaceae, is widely distributed in temperate and subtropical zones of Asian, European and American countries (Gisbert et al. 2009). Eriobotrya japonica originated in China and later was introduced to Mediterranean basin, Japan and Florida (Blasco et al. 2014). Eriobotrya japonica is an important economic fruit crop with high edible, medical as well as ornamental values. The fruit of E. japonica is greatly appreciated by consumers due to its good taste and high nutrition values. Its leaves, where pharmaceutically active compounds proved to be found (Sharpe 2010), have long been considered as one kind of traditional Chinese medicine. Due to natural multiplication and artificial cultivation for long time, genetic variation can be easily found within loquat which makes the identification and classification of loquat more difficult. Molecular markers such as RAPD, AFLP or SSRs have been rapidly developed these years and applied into loquat studies. Vilanova et al. (2001) applied RAPD technology into 33 loquat cultivars for identification from different regions. Soriano et al. (2005) first demonstrated the usefulness of SSRs markers in genetic analysis and identification in E. japonica. Many researches utilized AFLP and SSRs markers to investigate genetic variation, diversity and identification among loquat accessions (He et al. 2011; Fukuda et al. 2013; Blasco et al. 2014), which provided information for diversity analysis and plant breeding program. However, few molecular markers based on plastomes have been developed since completed plastid genome of E. japonica is not available, lagging behind other species of Rosaceae.

In this study, we report the first complete plastid genome of E. japonica using next-generation sequencing method (Illumina Hiseq 2000) and conduct comparative analysis with other Rosaceous species, P. pyrifolia and P. persica in particular, which will not only help with species identification or germplasm selection but also provide insights into phylogenetic evolution of Rosaceae family.

Methods

Taxon sampling, DNA sequencing and genome assembly

Fresh leaves of Eriobotrya japonica were collected from the nursery garden in Zhejiang University to prepare for isolation of chloroplast DNA. The two-step Percoll gradient method (Aronsson and Jarvis 2002) was used to isolate purified E. japonica chloroplasts. The chloroplast DNA was then extracted and purified using the CTAB method (He 2011) with slight modifications. The whole chloroplast library was constructed by 5 μg purified cp DNA. The cp genome of E. japonica was then sequenced using Illumina Hiseq 2000 system, which generated in total 4,484,369 raw pair-end reads for this project. As many low-quality reads were included in the generated raw reads, SolexaQA v1.0 (Cox et al. 2010) was used to filter low-quality reads with the settings-h 27 and-l 60. Then 6050 contigs with an average length of 206 bp were generated by Soapdenovo v1.3 (Luo et al. 2012) with Kmer size equal to 59 bp. The similar strategy with Zhang et al. (2014b) was then used for the assembly. The complete plastid genome of Pyrus pyrifolia (AP012207) extracted from NCBI (http://www.ncbi.nlm.nih.gov/) was selected as a reference and Blastz (Schwartz et al. 2003) perl script was used to map all contigs to the reference in order to determine the order and direction of these contigs. The following steps was taken repeatedly to fill up the gaps: first, BLAT v.34 (Kent 2002) was used to map raw sequence reads to both ends of the assembled contigs; second, assembled contigs were extended by connecting up with overlapping reads which were best overlapped with the contigs (Zhang et al. 2014b). For the gaps remaining between contigs, we designed six pairs of primers for PCR amplification to close these gaps (Additional file 1: Table S1). Also, to avoid mistakes during our assembly, another four primers were designed to confirm IR/SC boundaries (Additional file 1: Table S1). All PCR products were sequenced by conventional Sanger sequencing and the results were consistent with our assembly. Thus, the whole plastid genome of E. japonica was obtained.

Genome annotation, codon usage and comparative analysis

The Eriobotrya japonica plastid genome was annotated using the program Dual Organellar GenoMe Annotator (Wyman et al. 2004). Start and stop codons of protein-coding genes were then manually checked and adjusted if necessary, by comparing E. japonica with other Rosaceae plastomes. Any genes not found by DOGMA were verified missing by the use of blastn and blastx online searches (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Transfer RNA genes were identified and further confirmed with tRNAscan-SE 1.21 (Lowe and Eddy 1997) using the mito/chloroplast source setting. Then the whole record was deposited into Genbank with accession number KT633951. The physical map of the complete plastid genome was drawn by OGdraw v1.2 online tool (Lohse et al. 2007). Codon usage and relative synonymous codon usage (RSCU) analysis of all protein-coding genes were conducted using MEGA5 (Tamura et al. 2011). In order to perform identity analysis, seven Rosaceae cp genomes, Fragaria virginiana (NC_019602), Pentactina rupicola (JQ041763), Prinsepia utilis (NC_021455), Prunus persica (HQ336405), Pyrus pyrifolia (AP012207), and Rosa odorata (KF753637) were extracted from NCBI and were aligned with E. japonica respectively to compute pairwise identity using mVISTA program (Frazer et al. 2004). Large indels with no less than 40 bp in size were detected through pairwise alignment among E. japonica, P. pyrifolia and P. persica. For these unique large indels of E. japonica, five pairs of primers were also designed to avoid assembly errors (Additional file 2: Table S2).

Repeat structure identification

Reputer online program (Kurtz et al. 2001) was used to detect forward, palindrome, reverse and complementary repeat structures with structure size greater than 20 bp and hamming distance equal to 0 (100% identity).

Simple sequence repeats (SSRs) were detected within completed genomes of Eriobotrya. japonica using MISA v1.0 (Thiel et al. 2003) with parameter settings of mononucleotide, dinucleotide, tri- or tetranucleotide and hexanucleotide repeats no less than 10, 12, 15 and 24 bases respectively.

Nucleotide substitution in coding regions

All 78 functional protein-coding genes were extracted from Eriobotrya japonica, Pyrus pyrifolia and Prunus persica chloroplast genome. Each gene of P. pyrifolia and P. persica was aligned with that of E. japonica using clustalX v2.1 (Thompson et al. 1997). The alignment file was then put into Dnasp v5 (Librado and Rozas 2009) to calculate the synonymous (Ks) and nonsynonymous (Ka) substitution rates. Transition (Ts), transversion (Tv) and P-distance of each gene were calculated using MEGA5 (Tamura et al. 2011).

Phylogenetic analysis

All 78 protein-coding genes extracted from the plastomes of 7 Rosaceous plants (Fragaria virginiana, NC_019602; Pentactina rupicola, JQ041763; Prinsepia utilis, NC_021455; Prunus persica, HQ336405; Pyrus pyrifolia, AP012207; Rosa odorata, KF753637 and Eriobotrya japonica) and Morus indica (NC_008359, as an outgroup) were used to construct Maximum likelihood (ML) tree and Maximum parsimony (MP) tree. All 78 protein coding genes were concatenated and then aligned using MAFFT v7 (Katoh and Standley 2013). Gblock v0.91 (Talavera and Castresana 2007) was used to select the conserved regions, which resulted in a total length of 67,104 bases for MP and ML analysis. The aligned sequences of conserved regions were then tested in DAMBE v5.3.19 (Xia and Lemey 2009) for saturation of substitution. The results revealed that Iss (index of substitution saturation) < Iss.c (the critical Iss value), indicating no substantial saturation in these sequences (Xia et al. 2003). The General Time Reversible model of substitution, incorporating invariant sites and a gamma distribution (GTR + I+G), was selected as the best model by jmodeltest2.1.7 (Posada 2008). To construct the ML tree, RaxML7.0.4 (Stamatakis 2006) was used with 1000 non-parametric replications for bootstrap settings. The base frequences estimated by RaxML was 0.305 (A), 0.174 (C), 0.203 (G), 0.317 (T) while rate matrix was 1.54, 3.07, 0.24, 0.77, 3.37, 1.00 for ac, ag, at, cg, ct, gt, respectively. PAUP4.0b10 (Swofford 2003) was used to construct MP tree with the following options implemented: Accctran was used, gaps were treated as missing, heuristic search mode used 1000 replications for bootstrap support, tree bisection-reconnection (TBR) branch-swapping, MulTrees in effect, and steepest descent off.

Results

Genome features of E. japonica

The complete plastid genome of Eriobotrya japonica is 159,137 bp in length with a double-strand circle structure with a pair of IRs of 26,326 bp separated by a small single copy of 19,283 bp and a large single copy of 87,202 bp (Fig. 1). The plastid genome includes 112 functional genes in all, of which 78 are protein-coding genes, 30 are tRNA genes and 4 are rRNA genes (Table 1). Eighteen genes duplicates in IR region including 6 protein-coding genes, 7 tRNA genes and 4 rRNA genes. Eighteen genes comprising six tRNA genes contain one or two introns. Both ycf3 and clpP gene contain two introns while rps12 gene is trans-spliced with a share 5′ exon in LSC region and two 3′ exons located in IR region. Three genes, ycf1, rps19 and infA was found as non-functional genes in the E. japonica plastid genome. ycf1 and rps19, located in IR/SC boundary regions, became truncated as incomplete duplications of the normal copy. infA gene was found in R. odorata while it was non-functional in E. japonica and some other Rosaceae plastomes as several stop codons were identified in infA coding regions (Fig. 2).
Fig. 1

Gene map of E. japonica complete chloroplast genome. Exons are annotated by coloured boxes and introns are annotated with white boxes. Genes inside or outside of the large circle are respectively transcribed in the clockwise or counterclockwise direction. Boundaries of LSC, SSC, IR are annotated at inner circle. GC content is represented by dark grey graph within inner circle

Table 1

List of genes located in E. japonica

Group of genes

Gene names

Ribosomal RNA genes

rrn16 # ,rrn23 # ,rrn4.5 # ,rrn5 #

Transfer RNA genes

trnA-UGC* # , trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA, trnG-GCC*, trnG-UCC, trnH-GUG, trnI-CAU # , trnI-GAU* # , trnK-UUU*, trnL-CAA # , trnL-UAA*, trnL-UAG, trnM-CAU, trnfM-CAU, trnN-GUU # , trnP-UGG, trnQ-UUG, trnR-UCU, trnR-ACG # , trnS-UGA, trnS-GCU, trnS-GGA, trnT-GGU, trnT-UGU, trnV-UAC*, trnV-GAC # , trnW-CCA, trnY-GUA

Small subunit of ribosome

rps2, rps3, rps4, rps7 # , rps8, rps11, rps12*, rps14, rps15, rps16*, rps18, rps19 #

Large subunit of ribosome

rpl2* # , rpl14, rpl16*, rpl20, rpl22, rpl23 # , rpl32, rpl33, rpl36

DNA dependent RNA polymerase

rpoA, rpoB, rpoC1*, rpoC2

Subunits of photosystem I

psaA, psaB, psaC, psaI, psaJ

Subunits of photosystem II

psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ

Subunits of cytochrome

petA, petB*, petD*, petG, petL, petN

Subunits of ATP synthase

atpA, atpB, atpE, atpF*, atpH, atpI

ATP-dependent protease

clpP*

Large subunit of Rubisco

rbcL

Subunits of NADH

ndhA*, ndhB* # , ndhC, ndhD, ndhE, ndhF # , ndhG, ndhH, ndhI, ndhJ, ndhK

Maturase

matK

Envelop membrane protein

cemA

Subunit of Acetyl-CoA-carboxylase

accD

c-Type cytochrome synthesis gene

ccsA

Conserved open reading frames

ycf1, ycf2 # , ycf3*, ycf4

* Gene with intron

#Gene duplicated in IR

Fig. 2

Alignment of infA coding regions of seven Rosaceae plastid genomes. Asterisks mean stop codons while dots mean gaps

Overall, 22,772 codons encoding 78 functional protein-coding genes were identified from E. japonica plastid genome and classified depending on codon usage (Table 2). There were 2388 codons encoding for leucine and 252 codons for cysteine, which denoted respectively the most and the least amino acids. The RSCU analysis showed a great A/T bias in the protein-coding genes, especially in the third position of the codon with G/C content at 25.9%. This pattern has been identified in former studies (Redwan et al. 2015; Tangphatsornruang et al. 2011). However, whether this pattern relates to selection for translational efficiency or nucleotide compositional biases remains unclear.
Table 2

Codon usage and RSCU analysis of E. japonica cp genome

Amino acid

Codon

No.

RSCU

tRNA

Amino acid

Codon

No.

RSCU

tRNA

Phe

UUU

850

1.34

 

Tyr

UAU

691

1.61

 
 

UUC

420

0.66

trnF-GAA

 

UAC

166

0.39

trnY-GUA

Leu

UUA

814

2.05

trnL-UAA

TER

UAA

43

1.65

 
 

UUG

485

1.22

trnL-CAA

 

UAG

19

0.73

 
 

CUU

495

1.24

 

His

CAU

414

1.54

 
 

CUC

145

0.36

  

CAC

123

0.46

trnH-GUG

 

CUA

305

0.77

trnL-UAG

Gln

CAA

634

1.55

trnQ-UUG

 

CUG

144

0.36

  

CAG

182

0.45

 

Ile

AUU

987

1.50

 

Asn

AAU

834

1.55

 
 

AUC

364

0.55

trnI-GAU

 

AAC

244

0.45

trnN-GUU

 

AUA

622

0.95

 

Lys

AAA

904

1.53

trnK-UUU

Met

AUG

537

1.00

trnfM-CAU

 

AAG

281

0.47

 

Val

GUU

472

1.47

 

Asp

GAU

743

1.62

 
 

GUC

134

0.42

trnV-GAC

 

GAC

175

0.38

trnD-GUC

 

GUA

504

1.57

trnV-UAC

Glu

GAA

897

1.50

trnE-UUC

 

GUG

173

0.54

  

GAG

299

0.50

 

Ser

UCU

485

1.71

 

Cys

UGU

190

1.51

 
 

UCC

259

0.92

trnS-GGA

 

UGC

62

0.49

trnC-GCA

 

UCA

327

1.15

trnS-UGA

TER

UGA

16

0.62

 
 

UCG

155

0.55

 

Trp

UGG

396

1.00

trnW-CCA

Pro

CCU

363

1.56

 

Arg

CGU

301

1.33

trnR-ACG

 

CCC

172

0.74

  

CGC

97

0.43

 
 

CCA

268

1.15

trnP-UGG

 

CGA

312

1.38

 
 

CCG

130

0.55

  

CGG

99

0.44

 

Thr

ACU

483

1.64

 

Ser

AGU

364

1.29

 
 

ACC

211

0.72

trnT-GGU

 

AGC

109

0.39

 
 

ACA

363

1.23

trnT-UGU

Arg

AGA

407

1.80

trnS-GCU

 

ACG

123

0.41

  

AGG

138

0.61

 

Ala

GCU

590

1.85

 

Gly

GGU

528

1.35

 
 

GCC

194

0.61

  

GGC

166

0.42

trnG-GCC

 

GCA

349

1.10

trnA-UGC

 

GGA

620

1.58

trnG-UCC

 

GCG

141

0.44

  

GGG

254

0.65

 

Comparison with other plastid genomes in Rosaceae

Structure and content of Eriobotrya japonica plastid genome are conserved and share similar features with other Rosaceae plastid genomes (Table 3). The average length of six cp genomes is 157,619 bp. Among these seven Rosaceae plants, Pyrus pyrifolia is the largest in size at 159,922 bp while Fragaria virginiana is shortest at 155,621 bp. Eriobotrya japonica ranks following P. pyrifolia with 159,137 bp. P. pyrifolia contains the longest LSC and IR, which are 87,901 and 26,392 respectively. The SSC size of E. japonica is the largest, which is 46 bp longer than P. pyrifolia.
Table 3

Summary of seven Rosaceae plastid genome features

 

E. japonica

P. pyrifolia

P. rupicola

P. persica

F. virginiana

P. utilis

R. odorata

Accession

KT633951

NC_015996

NC_016921

NC_014697

NC_019602

NC_021455

KF753637

Length

159,137

159,922

156,612

157,790

155,621

156,328

156,634

LSC

87,202

87,901

84,970

85,968

85,586

85,239

85,767

SSC

19,283

19,237

18,941

19,060

18,145

18,485

18,761

IR

26,326

26,392

26,351

26,381

25,945

26,302

26053

GC% overall

36.7

36.6

36.8

36.8

37.2

36.9

37.2

in LSC

34.5

34.3

34.6

34.6

35.1

34.7

35.1

in IR

42.7

42.7

42.6

42.6

42.8

42.7

42.7

in SSC

30.3

30.4

30.6

30.6

31.1

30.5

31.2

Number in bold italics indicates the largest value of line

Number in italics indicates the smallest value of line

The multialignment of Rosaceae plastid genomes (Fig. 3) illustrated that the IR regions revealed higher identity in comparison with single copy (SC) regions. Eriobotrya japonica plastid genome is most similar to P. pyrifolia and most divergent from Rosa odorata and Fragaria virginiana. Another aspect is that coding regions show higher conservation than non-coding regions.
Fig. 3

Six Rosaceae plastid genomes were aligned with E. japonica pairwise. Y-scale stands for identity from 50 to 100%. Blue represents exons of protein-coding genes, lime represents tRNA or rRNA genes and red represents non-coding regions

The GC content is similar among these species ranging from 36.7 to 37.2% as the GC content of seed plants usually ranges from 34 to 40% (Guisinger et al. 2011; Yap et al. 2015; Cai et al. 2006; Raubeson et al. 2007). Rosa odorata and F. virginiana contain the highest GC content (37.2%) while P. pyrifolia contains the lowest (36.6%). In addition, IR regions contain the highest GC content followed by LSC and SSC regions.

Repeat structure

A total of 42 repeat structures containing no less than 20 bp with 100% identity were found (Additional file 3: Table S3). The number of direct, palindrome, complement and reverse structures are 29, 8, 3, 2, respectively. Of all these structures, the longest one is 59 bp located between rpl32 and trnL-UAG. Most repeat structures located in intergenic or intron regions while two repeat structures located in ycf1 gene.

Seventy-two simple sequence repeats including 70 mononucleotides and 2 dinucleotides were identified in E. japonica plastid genome (Table 4). Among 70 mononucleotides, 26 A stretches, 42 T stretches and 2 C stretches were detected while no G stretch was found. Two dinucleotide repeats, are both composed of A and T, 1 AT stretch (6 repeat motifs) and 1 TA (8 repeat motifs) stretch. The size of all SSRs are between 10 and 20 bp in length. Only five genes, atpB, rpoB, rpoC2, matK and ycf1 appear to harbor one or two SSRs while others are all located in intergenic or intron regions. The numbers of SSRs located in LSC, IR and SSC are 58, 4, and 10, respectively.
Table 4

Distribution of SSRs (mononucleotide) loci in the E. japonica chloroplast genome

Size (bp)

Number and start position

A stretch

C stretch

T stretch

G stretch

10

9 (13897, 62517, 68030, 84710, 115751, 117249, 124942, 125608, 143104)

0

17 (174, 4752, 8304, 9472, 9942, 11831, 13310, 14438, 14463, 16746, 26698, 56906, 84155, 85388, 86446, 103167, 130945)

0

11

6 (16759, 44490, 46845, 51587, 68061, 158959)

0

6 (2753, 6523, 9110, 12905, 18997, 87311)

0

12

3 (187, 27779, 79320)

0

4 (1612, 51543, 67720, 85645)

0

13

2 (48460, 74027)

0

1 (71138)

0

14

1 (37903)

2 (25627, 116685)

6 (12551, 32565, 37948, 65963, 73345, 123131)

0

15

1 (6806)

0

3 (71854, 74083, 116600)

0

16

4 (69960, 80822, 131576)

0

2 (14900, 125047)

0

17

1 (7681)

0

1 (82414)

0

18

0

0

0

0

19

0

0

1 (59616)

0

20

0

0

1 (83566)

0

Total

26

2

42

0

Nucleotide substitution and indels in Eriobotrya japonica, Pyrus pyrifolia and Prunus persica

In this research, 78 functional protein-coding genes were classified into eleven groups according to their function, the Ka/Ks among Pyrus pyrifolia, Prunus persica and Eriobotrya japonica were computed. Although protein-coding regions were always conserved among closely related groups, Ka and Ks varied in different regions (Table 5) and different functions (Additional file 4: Table S4). Both Ks and Ka of all regions between P. persica and E. japonica were higher than those between P. pyrifolia and E. japonica. In two comparisons, Ka and Ks were highest in SSC regions and lowest in IR regions. When compared with P. persica, psaC revealed the highest Ks while rps18 revealed the highest Ka and genes related with ATP synthase had the highest Ks value. When compared with P. pyrifolia, rpl32 and rpl36 revealed the highest Ks and Ka value respectively and genes of Photosystem I described the highest Ks value. The Ka/Ks values of all gene groups were less than one in both two comparisons (Fig. 4a) and only one gene accD contained the Ka/Ks value slightly greater than one when compared with P. pyrifolia.
Table 5

Synonymous rate, nonsynonymous rate, transition (Ts) and transversion (Tv) in LSC, IR and SSC regions among E. japonica, P. pyrifolia and P. persica

Region

E. japonica vs P. pyrifolia

E. japonica vs P. persica

Ks

Ka

Ts

Tv

Ks

Ka

Ts

Tv

LSC

0.0062

0.0014

209

313

0.0717

0.0091

1863

1706

IR

0.0035

0.00004

3

6

0.0110

0.0041

81

77

SSC

0.0091

0.0026

60

76

0.0942

0.0175

584

572

All

0.0053

0.0024

272

395

0.0694

0.0138

2528

2355

Ratio

Ka/Ks = 0.4528

Ts/Tv = 0.6858

Ka/Ks = 0.2126

Ts/Tv = 1.0964

Fig. 4

Nucleotide substitution analysis of different functional groups among E. japonica, P. pyrus and P. persica. Group A to K separately refers to small subunit of ribosome, large subunit of ribosome, RNA polymerase subunits, ATP synthase gene, NADH dehydrogenase, Cytochrome b/f complex, Photosystem I, Photosystem II, Large chain of Rubisco, Other genes and Unknown functions. a Synonymous (Ks) and nonsynonymous (Ka) ratios among three species. b Transtion (Ts) and transversion (Tv) ratios among three species

A total of 675 and 5040 nucleotide substitutions were found in E. japonica plastid genome when compared with P. pyrifolia and P. persica respectively. The LSC region contained the most nucleotide substitutions as it’s the largest area of the genome (Table 5). Transitions and transversions in coding regions are shown in Additional file 5: Table S5. Overall, transitions occurred more than transversions when compared with P. persica than with P. pyrifolia. Also, the Ts and Tv ratio varied among different gene groups (Fig.4b). Genes related with Small subunit of ribosome and Photosystem II had a relatively higher ratio in both two comparisons. Specially, the line charts of two comparisons both illustrated similar Ts/Tv tendency, which indicated a Ts/Tv bias for different functional groups.

Large indels (>40 bp) were also identified among these three species (Table 6). Compared to P. pyrifolia, 11 indels were detected in E. japonica plastid genome comprising 7 deletions and 4 insertions. The largest indel was a 417 bp deletion located in intergenic region between trnR-UCU and atpA. When compared to P. persica, 20 indels including 8 deletions and 12 insertions were identified. All large indels were distributed in non-coding regions of LSC and SSC, while none were located in IR regions.
Table 6

Large indels identified among E. japonica, P. pyrifolia and P. persica

Type

Eriobotrya vs Pyrus

Eriobotrya vs Prunus

Location

Size (bp)

Repeat motifs

Location

Size (bp)

Repeat motifs

Deletion

rps16-trnQ-UUG

182

polyA

rps16-trnQ-UUG

151

 

trnR-UCU-atpA

417

AAT

trnR-UCU-atpA

40

 

trnT-GGU-psbD

54

 

trnS-UGA-psbZ

58

 

psaA-ycf3

52

polyA

ndhC-trnV-UAC

48

 

ndhC-trnV-UAC

56

 

ndhC-trnV-UAC

44

 

ndhC-trnV-UAC

48

polyT

trnM-CAU-atpE

45

TTTTG

rpl2-trnH-GUG

50

 

ccsA-ndhD

50

AA

   

rpl2-trnH-GUG

96

TA

Insertion

petN-psbM

79

TTCG

rps16-trnQ-UUG

138

 
 

trnT-UGU-trnL-UAA

42

CTCAAATATATGTTTATCAAT

trnS-GCU-trnG-GCC

151

 
 

rpl32-trnL-UAG

69

 

rpoB-trnC-GCA

47

 
 

accD-psaI

129

AA

rpoB-trnC-GCA

124

 
 

psbZ-trnG-GCC

148

 
 

rps4-trnT-UGU

48

 
 

trnT-UGU-trnL-UAA

42

 
 

trnT-UGU-trnL-UAA

78

 
 

rpl33-rps18

61

TTTAT

 

rps18-rpl20

146

 
 

ndhF-rpl32

191

AATTT

 

rpl32-trnL-UAG

59

 

IR expansion and contraction

The SC and IR boundaries of six Rosaceae plastid genomes were aligned in Fig. 5. Eriobotrya japonica contained almost the same IR/SC structure with Pyrus pyrifolia, Prunus persica and Pentactina rupicola in which IRb/SC boundaries lay respectively in coding regions of rps19 and ndhF. Rosa odorata and Fragaria virginiana contained another structure with rps19 gene and ndhF gene apart from LSC/IRb boundary, which led to the loss of rps19 pseudogene at LSC/IRa boundary. Prinsepia utilis contained a LSC/IRb boundary with rps19 involved and a IRb/SSC boundary apart from ndhF. The IRa/SSC boundary of all six species extended to ycf1 coding regions with the range from 978 bp (P. utilis) to 1105 bp (R. odorata), which led to a nonfunctional ycf1 gene in IRb. The IRa/LSC boundary revealed a large variation from 4 (R. odorata) to 104 bp (P. pyrifolia) as trnH-GUG gene located upstream of IRa/LSC boundary.
Fig. 5

The comparison of IR boundary among 7 Rosaceae plants. Annotated genes are represented by black boxes. Psi letter means pseudogene

Phylogenetic analysis

All 78 protein-coding genes possessed by seven Rosaceae plastomes were extracted to perform ML and MP analysis using Morus indica as an outgroup.

Maximum likelihood analysis resulted in a single tree with—lnL of 150822.7449 using GTR + G + I substitution model. Maximum parsimony analysis generated one most parsimonious tree with a length of 10,628, a consistency index of 0.8852, and a retention index of 0.7117. Our MP (Additional file 6: Fig. S1) and ML (Fig. 6) trees shared similar topology. Both of them strongly supported a clade of Fragaria viginiana and Rosa odorata as sister to the remaining sampled Rosaceae species. Prunus persica and Prinsepia utilis form a clade sister to Pentactina rupicola, Pyrus pyrifolia, and Eriobotrya japonica. Pyrus pyrifolia and Eriobotrya japonica are sister to each other with a 100% bootstrap value.
Fig. 6

Maximum likelihood (ML) analysis using 78 protein-coding genes within Rosaceae family. Bootstrap values are displayed at the nodes. Length scale behind the tree indicates substitutions per site

Discussion

We compared Eriobotrya japonica with available sequences of Rosaceae plastid genomes, indicating the conservation of E. japonica plastid genome with similar structure and gene content. However, one significant difference among these species is that Rosa odorata encodes infA gene which is non-functional in other plastid genomes due to several stop codons in coding regions (Fig. 2). It’s well recognized that plastid DNA transfers to nuclear DNA at a considerably high rate (Huang et al. 2003). However, until now, successful gene transfers to nuclear genome have been documented for only four genes in Rosids, infA, rpl22, rpl32 and rpoA (Jansen et al. 2011). infA gene, which encodes for translation initiation factor1 was reported to transfer from plastid genome to nuclear genome for functional use several times especially in Rosids (Millen et al. 2001). So further studies could be focused on gene evolution of infA in Rosaceae.

Simple sequence repeats (SSRs) have been widely used as molecular markers, which is useful for plant breeding and linkage map construction. However, due to the lack of plastid genomes in Rosaceae, few chloroplast SSRs have been utilized. In this study, a total of 72 SSRs have been found. SSRs are much more abundant in non-coding regions as they always contain more mutations than conserved coding regions (Bodin et al. 2013). Of all 72 SSRs, A and T stretches accounted for 97%, which was similar with the observation in Pyrus pyrifolia plastid genome where 31 A stretches, 34 T stretches, 2 C stretches and no G stretch were detected (Terakami et al. 2012). These results reveal that SSR has a strong AT bias which is consistent with many studies (Ma et al. 2013; Kuang et al. 2011; Do et al. 2013).

Large indels (>40 bp) were found through the comparison among E. japonica, P. pyrifolia and P. persica. The distribution of large indels revealed that IR regions as well as coding regions were more conserved than other regions as none of large indels located in IR and coding regions. Many of indels were found to be flanked by short repeated motifs or polyA or T structures (Table 6), suggesting that many large indels could be attributed to slipped-strand mispairing (Levinson and Gutman 1987; Terakami et al. 2012). Five large indels were unique in E. japonica plastid genome including 4 deletions and 1 insertion and were located in rps16-trnQ-UUG, trnR-UCU-atpA, ndhC-trnV-UAC, rpl2-trnH-GUG and trnT-UGU-trnL-UAA, respectively. Pentactina rupicola plastid genome was then checked for these indels and the results showed that the deletion at ndhC-trnV-UAC was found in P. rupicola, which suggested that the other four indels might be unique to Eriobotrya genus.

The Ka and Ks ratio has been used to denote the rate of divergence and methods of selection pressure. The value of less than, equal to or great than 1 have been considered as purifying, neutral or positive selection, respectively (Redwan et al. 2015). Pyrus pyrifolia revealed a lower divergence than P. persica from E. japonica as Ka and Ks between E. japonica and P. pyrifolia were much lower (Additional file 4: Table S4). Both Ka and Ks in IR regions were much lower than those in LSC and SSC (Table 5), which suggested that IR region evolved at a slower rate than LSC and SSC (Yi and Kim 2012). The Ka and Ks ratios of all gene groups were lower than 1, suggesting that a purifying selection might act on most E. japonica chloroplast genes.

It has been documented that the higher Ts and Tv ratio denotes lower level of divergence and lower ratio denotes higher level of divergence (Yang and Yoder 1999; Dane et al. 2015). This might be a little incompatible with our results that Ts/Tv value is lower when compared with P. pyrifolia since the closest relationship between P. pyrifolia and E. japonica (Table 5). From another perspective, P-distance (nucleotide substitution per site) value was found to be much smaller in P. pyrifolia than in P. persica compared to E. japonica (Additional file 5: Table S5). Thus, we can infer that the lower Ts and Tv ratio between P. pyrifolia and E. japonica may be caused by extremely low Ts rate, which would then be consistent with a lower divergence between E. japonica and P. pyrifolia. If both P-distance and Ts/Tv value are considered, ycf1 with 0.068 P-distance and 0.906 Ts/Tv value are regarded as the most divergent gene of all, which could be utilized as DNA barcode for identification.

Phylogenic analysis based on plastid genome has been rapidly developed as more and more researchers use single genes, multiple genes or different regions of plastid genome to perform phylogenetic reconstruction (Wang et al. 2013; Walker et al. 2014; Zhang et al. 2014a). Rosaceae contains nearly a hundred genera with high economic values. Yet, taxa relationship among Rosaceae has not been investigated enough and is still vague. Su et al. (2014) performed maximum likelihood analysis within Rosids using 62 conserved chloroplast genes, which suggested but with low bootstrap that P. persica and P. rupicola formed a clade while P. pyrifolia and P. utilis formed another clade. However, another ML analysis was performed using 78 protein-coding genes (Wang et al. 2013) described that P. persica and P. utilis formed a clade while P. pyrifolia and P. rupicola formed another clade. As these two studies were incongruent, we included those four genera, along with R. odorata, F. virginiana and E. japonica in our phylogenetic analysis to clarify the internal relationships within Rosaceae. Our phylogeny was similar to that of Wang et al. (2013), but with higher bootstrap values. This is also consistent with traditional studies that put Eriobotrya (loquat) and Pyrus (pear) into the subfamily Maloideae. Due to the lack of Rosaceae plastid genomes available online, in future study, more plastomes such as Spiraeae need to be involved to construct a larger-scale phylogeny within Rosaceae.

Conclusions

The complete plastid genome of E. japonica is 159,137 bp in length with a typical quadripartite structure. Comparison with other Rosaceae species revealed that E. japonica plastid genome is quite conserved in gene content and structure and showed the highest identity with P. pyrifolia. A total of 72 SSRs were found including two dinucleotide repeats and most of them were composed of A/T, which showed a strong A/T bias in base composition of SSRs. Four large indels appeared to be unique to E. japonica and could be utilized as markers for intergeneric identification. The Ka and Ks value among three species revealed differences among different genes and Ka/Ks was always less than 1, suggesting a purifying selection on these genes. Both MP and ML phylogenetic analysis shared similar topology and strongly supported the closest relationship between E. japonica and P. pyrifolia.

Declarations

Authors’ contributions

LZ, JT, ML and LS designed the experiments. LS, QG, XL, ML and AA prepared samples and performed the experiments. LS and ML did the sequence assembly. WZ, LS, QG contributed to the analysis of data. LS, WZ and AA designed and drafted the manusript. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by National Natural Science Foundation of China (No. 81274033), Science and Technology Support Program of Jiangsu Province (No. BE2014654), and Changshu Technology Support Program (No. CS201405).

Competing interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential competing interests.

Availability of data and materials

The dataset(s) supporting the conclusions of this article is(are) available in the NCBI repository, under Accession number KT633951.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Department of Biomedical Engineering, Zhejiang University
(2)
Changshu Qiushi Technology Co. Ltd.

References

  1. Aronsson H, Jarvis P (2002) A simple method for isolating import-competent Arabidopsis chloroplasts. FEBS Lett 529(2–3):215–220. doi:10.1016/S0014-5793(02)03342-2 View ArticleGoogle Scholar
  2. Blasco M, del Mar Naval M, Zuriaga E, Badenes ML (2014) Genetic variation and diversity among loquat accessions. Tree Genet Genome 10(5):1387–1398View ArticleGoogle Scholar
  3. Bodin SS, Kim JS, Kim JH (2013) Complete chloroplast genome of Chionographis japonica (Willd.) Maxim. (Melanthiaceae): comparative genomics and evaluation of universal primers for Liliales. Plant Mol Biol Rep 31(6):1407–1421. doi:10.1007/s11105-013-0616-x View ArticleGoogle Scholar
  4. Cai ZQ, Penaflor C, Kuehl JV, Leebens-Mack J, Carlson JE, dePamphilis CW, Boore JL, Jansen RK (2006) Complete plastid genome sequences of Drimys, Liriodendron, and Piper: implications for the phylogenetic relationships of magnoliids. BMC Evol Biol 6:77. doi:10.1186/1471-2148-6-77 View ArticleGoogle Scholar
  5. Cho KS, Yun BK, Yoon YH, Hong SY, Mekapogu M, Kim KH, Yang TJ (2015) Complete chloroplast genome sequence of tartary buckwheat (Fagopyrum tataricum) and comparative analysis with common buckwheat (F. esculentum). PLoS ONE 10(5):0125332Google Scholar
  6. Cox MP, Peterson DA, Biggs PJ (2010) SolexaQA: at-a-glance quality assessment of Illumina second-generation sequencing data. BMC Bioinformatics. doi:10.1186/1471-2105-11-485 Google Scholar
  7. Dane F, Wang Z, Goertzen L (2015) Analysis of the complete chloroplast genome of Castanea pumila var. pumila, the Allegheny chinkapin. Tree Genet Genomes 11(1):1–6View ArticleGoogle Scholar
  8. Do HDK, Kim JS, Kim JH (2013) Comparative genomics of four Liliales families inferred from the complete chloroplast genome sequence of Veratrum patulum O. Loes. (Melanthiaceae). Gene 530(2):229–235. doi:10.1016/j.gene.2013.07.100 View ArticleGoogle Scholar
  9. Frazer KA, Pachter L, Poliakov A, Rubin EM, Dubchak I (2004) VISTA: computational tools for comparative genomics. Nucleic Acids Res 32:W273–W279. doi:10.1093/nar/gkh458 View ArticleGoogle Scholar
  10. Fukuda S, Nishitani C, Hiehata N (2013) Genetic diversity of loquat accessions in Japan as assessed by SSR markers. J Jpn Soc Hortic Sci 82(2):131–137View ArticleGoogle Scholar
  11. Gisbert AD, Romero C, Martínez-Calvo J, Leida C, Llácer G, Badenes ML (2009) Genetic diversity evaluation of a loquat (Eriobotrya japonica (Thunb) Lindl) germplasm collection by SSRs and S-allele fragments. Euphytica 168(1):121–134View ArticleGoogle Scholar
  12. Goulding SE, Olmstead RG, Morden CW, Wolfe KH (1996) Ebb and flow of the chloroplast inverted repeat. Mol Gen Genet 252(1–2):195–206. doi:10.1007/Bf02173220 View ArticleGoogle Scholar
  13. Guisinger MM, Kuehl JV, Boore JL, Jansen RK (2011) Extreme reconfiguration of plastid genomes in the angiosperm family Geraniaceae: rearrangements, repeats, and codon usage. Mol Biol Evol 28(1):583–600. doi:10.1093/molbev/msq229 View ArticleGoogle Scholar
  14. He X (2011) DNA extraction of seven species plants of Melastomaceae using modified CTAB method. Chin J Trop Agric 10:020Google Scholar
  15. He Q, Li XW, Liang GL, Ji K, Guo QG, Yuan WM, Zhou GZ, Chen KS, van de Weg WE, Gao ZS (2011) Genetic diversity and identity of Chinese loquat cultivars/accessions (Eriobotrya japonica) using apple SSR markers. Plant Mol Biol Rep 29(1):197–208View ArticleGoogle Scholar
  16. Huang CY, Ayliffe MA, Timmis JN (2003) Direct measurement of the transfer rate of chloroplast DNA into the nucleus. Nature 422(6927):72–76. doi:10.1038/nature01435 View ArticleGoogle Scholar
  17. Jansen RK, Cai Z, Raubeson LA, Daniell H, Depamphilis CW, Leebens-Mack J, Muller KF, Guisinger-Bellian M, Haberle RC, Hansen AK, Chumley TW, Lee SB, Peery R, McNeal JR, Kuehl JV, Boore JL (2007) Analysis of 81 genes from 64 plastid genomes resolves relationships in angiosperms and identifies genome-scale evolutionary patterns. Proc Natl Acad Sci USA 104(49):19369–19374. doi:10.1073/pnas.0709121104 View ArticleGoogle Scholar
  18. Jansen RK, Saski C, Lee SB, Hansen AK, Daniell H (2011) Complete plastid genome sequences of three rosids (Castanea, Prunus, Theobroma): evidence for at least two independent transfers of rpl22 to the nucleus. Mol Biol Evol 28(1):835–847. doi:10.1093/molbev/msq261 View ArticleGoogle Scholar
  19. Kalkman C (1988) The phylogeny of the rosaceae. Bot J Linn Soc 98(1):37–59. doi:10.1111/j.1095-8339.1988.tb01693.x View ArticleGoogle Scholar
  20. Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30(4):772–780. doi:10.1093/molbev/mst010 View ArticleGoogle Scholar
  21. Keeling PJ (2004) Diversity and evolutionary history of plastids and their hosts. Am J Bot 91(10):1481–1493. doi:10.3732/ajb.91.10.1481 View ArticleGoogle Scholar
  22. Kent WJ (2002) BLAT—The BLAST-like alignment tool. Genome Res 12(4):656–664. doi:10.1101/gr.229202 View ArticleGoogle Scholar
  23. Kuang DY, Wu H, Wang YL, Gao LM, Zhang SZ, Lu L (2011) Complete chloroplast genome sequence of Magnolia kwangsiensis (Magnoliaceae): implication for DNA barcoding and population genetics. Genome 54(8):663–673. doi:10.1139/G11-026 View ArticleGoogle Scholar
  24. Kurtz S, Choudhuri JV, Ohlebusch E, Schleiermacher C, Stoye J, Giegerich R (2001) REPuter: the manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res 29(22):4633–4642. doi:10.1093/nar/29.22.4633 View ArticleGoogle Scholar
  25. Levinson G, Gutman GA (1987) Slipped-strand mispairing—a major mechanism for DNA-sequence evolution. Mol Biol Evol 4(3):203–221Google Scholar
  26. Librado P, Rozas J (2009) DNASP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25(11):1451–1452. doi:10.1093/bioinformatics/btp187 View ArticleGoogle Scholar
  27. Lohse M, Drechsel O, Bock R (2007) OrganellarGenomeDRAW (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr Genet 52(5–6):267–274. doi:10.1007/s00294-007-0161-y View ArticleGoogle Scholar
  28. Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25(5):955–964. doi:10.1093/nar/25.5.955 View ArticleGoogle Scholar
  29. Luo RB, Liu BH, Xie YL, Li ZY, Huang WH, Yuan JY, He GZ, Chen YX, Pan Q, Liu YJ, Tang JB, Wu GX, Zhang H, Shi YJ, Liu Y, Yu C, Wang B, Lu Y, Han CL, Cheung DW, Yiu SM, Peng SL, Zhu XQ, Liu GM, Liao XK, Li YR, Yang HM, Wang J, Lam TW, Wang J (2012) SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler. Gigascience. doi:10.1186/2047-217x-1-18 Google Scholar
  30. Ma J, Yang B, Zhu W, Sun L, Tian J, Wang X (2013) The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms. Gene 528(2):120–131View ArticleGoogle Scholar
  31. Millen RS, Olmstead RG, Adams KL, Palmer JD, Lao NT, Heggie L, Kavanagh TA, Hibberd JM, Gray JC, Morden CW (2001) Many parallel losses of infA from chloroplast DNA during angiosperm evolution with multiple independent transfers to the nucleus. Plant Cell 13(3):645–658View ArticleGoogle Scholar
  32. Nguyen PAT, Kim JS, Kim JH (2015) The complete chloroplast genome of colchicine plants (Colchicum autumnale L. and Gloriosa superba L.) and its application for identifying the genus. Planta 242(1):223–237View ArticleGoogle Scholar
  33. Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25(7):1253–1256. doi:10.1093/molbev/msn083 View ArticleGoogle Scholar
  34. Potter D, Eriksson T, Evans RC, Oh S, Smedmark JEE, Morgan DR, Kerr M, Robertson KR, Arsenault M, Dickinson TA, Campbell CS (2007) Phylogeny and classification of Rosaceae. Plant Syst Evol 266(1–2):5–43. doi:10.1007/s00606-007-0539-9 View ArticleGoogle Scholar
  35. Raubeson LA, Peery R, Chumley TW, Dziubek C, Fourcade HM, Boore JL, Jansen RK (2007) Comparative chloroplast genomics: analyses including new sequences from the angiosperms Nuphar advena and Ranunculus macranthus. BMC Genom 8(1):174View ArticleGoogle Scholar
  36. Redwan R, Saidin A, Kumar S (2015) Complete chloroplast genome sequence of MD-2 pineapple and its comparative analysis among nine other plants from the subclass Commelinidae. BMC Plant Biol 15(1):1View ArticleGoogle Scholar
  37. Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W (2003) Human-mouse alignments with BLASTZ. Genome Res 13(1):103–107. doi:10.1101/gr.809403 View ArticleGoogle Scholar
  38. Sharpe RH (2010) Loquat: botany and horticulture. Horticult Rev 23:233Google Scholar
  39. Soriano JM, Romero C, Vilanova S, Llacer G, Badenes ML (2005) Genetic diversity of loquat germplasm (Eriobotrya japonica (Thunb) Lindl) assessed by SSR markers. Genome 48(1):108–114. doi:10.1139/G04-101 View ArticleGoogle Scholar
  40. Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22(21):2688–2690. doi:10.1093/bioinformatics/btl446 View ArticleGoogle Scholar
  41. Su HJ, Hogenhout SA, Al-Sadi AM, Kuo CH (2014) Complete chloroplast genome sequence of omani lime (Citrus aurantiifolia) and comparative analysis within the Rosids. PLoS ONE 9(11):113049View ArticleGoogle Scholar
  42. Swofford DL (2003) PAUP*. Phylogenetic analysis using parsimony (*and other Methods). Version 4Google Scholar
  43. Talavera G, Castresana J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biol 56(4):564–577. doi:10.1080/10635150701472164 View ArticleGoogle Scholar
  44. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28(10):2731–2739. doi:10.1093/molbev/msr121 View ArticleGoogle Scholar
  45. Tangphatsornruang S, Uthaipaisanwong P, Sangsrakru D, Chanprasert J, Yoocha T, Jomchai N, Tragoonrung S (2011) Characterization of the complete chloroplast genome of Hevea brasiliensis reveals genome rearrangement, RNA editing sites and phylogenetic relationships. Gene 475(2):104–112. doi:10.1016/j.gene.2011.01.002 View ArticleGoogle Scholar
  46. Terakami S, Matsumura Y, Kurita K, Kanamori H, Katayose Y, Yamamoto T, Katayama H (2012) Complete sequence of the chloroplast genome from pear (Pyrus pyrifolia): genome structure and comparative analysis. Tree Genet Genomes 8(4):841–854. doi:10.1007/s11295-012-0469-8 View ArticleGoogle Scholar
  47. Thiel T, Michalek W, Varshney RK, Graner A (2003) Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet 106(3):411–422. doi:10.1007/s00122-002-1031-0 View ArticleGoogle Scholar
  48. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25(24):4876–4882View ArticleGoogle Scholar
  49. Vilanova S, Badenes ML, Martinez-Calvo J, Llacer G (2001) Analysis of loquat germplasm (Eriobotrya japonica Lindl) by RAPD molecular markers. Euphytica 121(1):25–29. doi:10.1023/A:1012051207948 View ArticleGoogle Scholar
  50. Walker JF, Zanis MJ, Emery NC (2014) Comparative analysis of complete chloroplast genome sequence and inversion variation in Lasthenia Burkei (Madieae, Asteraceae). Am J Bot 101(4):722–729. doi:10.3732/ajb.1400049 View ArticleGoogle Scholar
  51. Wang S, Shi C, Gao LZ (2013) Plastid genome sequence of a wild woody oil species, Prinsepia utilis, provides insights into evolutionary and mutational patterns of rosaceae chloroplast genomes. PLoS ONE 8(9):e73946. doi:10.1371/journal.pone.0073946 View ArticleGoogle Scholar
  52. Wyman SK, Jansen RK, Boore JL (2004) Automatic annotation of organellar genomes with DOGMA. Bioinformatics 20(17):3252–3255. doi:10.1093/bioinformatics/bth352 View ArticleGoogle Scholar
  53. Xia X, Lemey P (2009) Assessing substitution saturation with DAMBE. In: Salemi M (ed) The phylogenetic handbook: a practical approach to DNA and protein phylogeny, 2nd edn. Cambridge University Press, Cambridge, pp 615–630View ArticleGoogle Scholar
  54. Xia X, Xie Z, Salemi M, Chen L, Wang Y (2003) An index of substitution saturation and its application. Mol Phylogenet Evol 26(1):1–7View ArticleGoogle Scholar
  55. Yang ZH, Yoder AD (1999) Estimation of the transition/transversion rate bias and species sampling. J Mol Evol 48(3):274–283. doi:10.1007/Pl00006470 View ArticleGoogle Scholar
  56. Yap J-YS, Rohner T, Greenfield A, Van Der Merwe M, McPherson H, Glenn W, Kornfeld G, Marendy E, Pan AY, Wilton A (2015) Complete chloroplast genome of the wollemi pine (Wollemia nobilis): structure and evolution. PLoS ONE 10(6):e0128126View ArticleGoogle Scholar
  57. Yi DK, Kim KJ (2012) Complete chloroplast genome sequences of important oilseed crop Sesamum indicum L. PLoS ONE 7(7):e35872View ArticleGoogle Scholar
  58. Yi X, Gao L, Wang B, Su YJ, Wang T (2013) The complete chloroplast genome sequence of Cephalotaxus oliveri (Cephalotaxaceae): evolutionary comparison of Cephalotaxus chloroplast dnas and insights into the loss of inverted repeat copies in gymnosperms. Genome Biol Evol 5(4):688–698. doi:10.1093/gbe/evt042 View ArticleGoogle Scholar
  59. Zhang Y, Li L, Yan TL, Liu Q (2014a) Complete chloroplast genome sequences of Praxelis (Eupatorium catarium Veldkamp), an important invasive species. Gene 549(1):58–69. doi:10.1016/j.gene.2014.07.041 View ArticleGoogle Scholar
  60. Zhang YZ, Ma J, Yang BX, Li RY, Zhu W, Sun LL, Tian JK, Zhang L (2014b) The complete chloroplast genome sequence of Taxus chinensis var mairei (Taxaceae): loss of an inverted repeat region and comparative analysis with related species. Gene 540(2):201–209. doi:10.1016/j.gene.2014.02.037 View ArticleGoogle Scholar

Copyright

© The Author(s) 2016