Skip to main content

Table 6 Large indels identified among E. japonica, P. pyrifolia and P. persica

From: Complete plastid genome of Eriobotrya japonica (Thunb.) Lindl and comparative analysis in Rosaceae

Type Eriobotrya vs Pyrus Eriobotrya vs Prunus
Location Size (bp) Repeat motifs Location Size (bp) Repeat motifs
Deletion rps16-trnQ-UUG 182 polyA rps16-trnQ-UUG 151  
trnR-UCU-atpA 417 AAT trnR-UCU-atpA 40  
trnT-GGU-psbD 54   trnS-UGA-psbZ 58  
psaA-ycf3 52 polyA ndhC-trnV-UAC 48  
ndhC-trnV-UAC 56   ndhC-trnV-UAC 44  
ndhC-trnV-UAC 48 polyT trnM-CAU-atpE 45 TTTTG
rpl2-trnH-GUG 50   ccsA-ndhD 50 AA
    rpl2-trnH-GUG 96 TA
Insertion petN-psbM 79 TTCG rps16-trnQ-UUG 138  
  trnT-UGU-trnL-UAA 42 CTCAAATATATGTTTATCAAT trnS-GCU-trnG-GCC 151  
  rpl32-trnL-UAG 69   rpoB-trnC-GCA 47  
  accD-psaI 129 AA rpoB-trnC-GCA 124  
  psbZ-trnG-GCC 148  
  rps4-trnT-UGU 48  
  trnT-UGU-trnL-UAA 42  
  trnT-UGU-trnL-UAA 78  
  rpl33-rps18 61 TTTAT
  rps18-rpl20 146  
  ndhF-rpl32 191 AATTT
  rpl32-trnL-UAG 59