Open Access

Population genetic analysis reveals a low level of genetic diversity of ‘Candidatus Phytoplasma aurantifolia’ causing witches’ broom disease in lime

  • Shaikha Y. Al-Abadi1,
  • Abdullah M. Al-Sadi2Email authorView ORCID ID profile,
  • Matthew Dickinson3,
  • Mohammed S. Al-Hammadi4,
  • Rashid Al-Shariqi4,
  • Rashid A. Al-Yahyai2,
  • Elham A. Kazerooni5 and
  • Assunta Bertaccini6
SpringerPlus20165:1701

https://doi.org/10.1186/s40064-016-3401-0

Received: 7 March 2016

Accepted: 27 September 2016

Published: 3 October 2016

Abstract

Witches’ broom disease of lime (WBDL) is a serious phytoplasma disease of acid lime in Oman, the UAE and Iran. Despite efforts to study it, no systemic study attempted to characterize the relationship among the associated phytoplasma, ‘Candidatus Phytoplasma aurantifolia’, from the three countries. This study utilized sequences of the 16S rRNA, imp and secA genes to characterize 57 strains collected from Oman (38), the UAE (9) and Iran (10). Phylogenetic analysis based on the 16S rRNA gene showed that the 57 strains shared 98.5–100 % nucleotide similarity to each other and to strains of ‘Ca. P. aurantifolia’ available in GenBank. The level of genetic diversity was low based on the 16S rRNA (0-0.011), imp (0–0.002) and secA genes (0–0.015). The presence of low level of diversity among phytoplasma strains from Oman, the UAE and Iran can be explained by the movement of infected lime seedlings from one country to another through trading and exchange of infected plants. The study discusses implication of the findings on WBDL spread and management.

Keywords

WBDL Phytoplasma Acid lime Population structure

Background

Citrus fruits are among the most important fruits in the world due to their high nutritional value and possibility to be consumed fresh as well as processed. Orange trees are the most widely cultivated citrus species, with Brazil being the largest orange exporter in the world. Lime and lemon trees are also cultivated extensively around the globe. India, with about 16 % of the world’s overall lemon and lime production, tops the production list, followed by Mexico (~14.5 %), Argentina (~10 %), Brazil (~8 %), and Spain (~7 %) (FAO 2015).

Citrus aurantifolia Swingle, known locally as Omani lime, has many other names in other parts of the world, such as Mexican lime, key lime and acid lime. It has been grown in Oman for at least four centuries where it was brought by Arabian sailors (Davies and Albrigo 1994). It was considered as the second most important fruit crop after dates in Oman until the 1970s, and today it is ranked among the top four fruit crops in terms of production. It is also an important crop in the UAE and Iran (FAO 2015).

Witches’ broom disease (WBDL) is the most destructive disease of lime trees in Oman, the UAE and Iran (Chung et al. 2006; Al-Yahyai et al. 2015; Al-Sadi et al. 2012b; Bové et al. 2000) where it killed more than a million lime trees. ‘Candidatus Phytoplasma aurantifolia’ is the phytoplasma associated with WBDL (Zreik et al. 1995). Phytoplasmas are phloem-limited bacteria which can be transmitted by phloem feeding insects such as leafhoppers and psyllids. WBDL was first observed in Shinas and Liwa in the northern coast of Al-Batinah governorate in the 1970s, then it spread rapidly to other parts of Oman (Bové et al. 1988). It was reported in the UAE in 1989 and in Iran in the 1990s (Garnier et al. 1991; Bové et al. 2000). WBDL results in the production of a large number of leaves, light green to yellow in color and smaller in size. This is also associated with production of many branches. Leaves on the symptomatic branches usually dry within 1 year of symptom appearance. WBDL symptoms progress on the entire canopy until the whole tree collapses and dies within three to 7 years of first symptom appearance (Al-Yahyai et al. 2015; Al-Sadi et al. 2012b).

The classification system of phytoplasmas is based on RFLP and/or sequencing of 16S rDNA (Schneider et al. 1995), while in the past, phytoplasma strains were differentiated according to their biological properties such as the similarity in symptoms, plant host, and insect vectors. This way of classification was laborious, time-consuming and not reliable. Recently a number of genetic markers have been developed for differentiation among phytoplasma strains, including immunodominant membrane protein (imp) and secA genes (Siampour et al. 2012; Bekele et al. 2011; Hodgetts et al. 2008).

Despite studies conducted on ‘Ca. P. aurantifolia’ in Oman and elsewhere there is a lack of knowledge concerning diversity and genetic relationship among ‘Ca. P. aurantifolia’ strains. This study was conducted to investigate the diversity of the strains infecting acid lime in Oman, the UAE and Iran based on 16S rRNA, secA, and imp genes, and to determine the ability of the latter two genes to discriminate ‘Ca. P. aurantifolia’ strains from phytoplasmas belonging to other ribosomal groups. Knowledge gained about relationships among the WBDL phytoplasma isolates from the three countries will help in developing plans for management strategies to contain WBDL spreading.

Results

Survey and sample collection

Surveys in Oman, UAE and Iran showed the presence of typical symptoms of witches’ broom disease in the three countries. Disease symptoms were characterized by appearance of dense growth of shoots, clustering of leaves and branches, and reduction in size and yellowing of leaves (Fig. 1). Dieback symptoms were also observed in one farm in Al-Ain (UAE). Severity of the disease was variable among farms and could not be quantified due to the tendency of many farmers to remove symptomatic branches as soon as they appear. The total samples which were collected during this study were 75 from Oman, 20 from Iran and 20 from the UAE. However, only samples which yielded good quality sequences of the 16S rRNA, imp and secA genes (38 from Oman, 10 from Iran and 9 from the UAE) were included in further analysis.
Fig. 1

Symptomatic and asymptomatic branches on an acid lime infected by ‘Ca. P. aurantifolia’

Phytoplasma diversity on 16S rRNA, secA and imp genes

PCR analysis of 57 acid lime samples based on the 16-23S rRNA using P1/P7 and R16R2/R16F2n produced fragments of 1784 base pairs (bp) and 1238–1248 bp, respectively (Table 2). Only fragments of 1238 bp representing the 16S rRNA gene of the strains were used in the phylogenetic analysis. Comparison of these sequences showed that strains shared 98.5–100 % (average 99.7 %) nucleotide similarity to each other and 99.4 % similarity to the reference strain of lime witches’ broom phytoplasma from Oman in GenBank (Accession number: EF186828). All strains from Oman clustered with reference strains of ‘Ca. P. aurantifolia’ (subgroup 16SII-B) from GenBank (Fig. 2). Analysis of genetic divergence among ‘Ca. P. aurantifolia’ strains based on 16S rRNA gene showed that the range of divergence was 0–0.003 for Omani strains, 0–0.002 for UAE strains and 0–0.002 for the Iranian strains (Table 3). The overall level of divergence based on all ‘Ca. P. aurantifolia’ from this study and from reference strains was 0.000–0.011 (avg. 0.001).
Fig. 2

A phylogenetic tree showing analysis of 57 phytoplasma isolates from Oman, UAE and Iran with phytoplasma reference sequences from 16S rRNA Group II. The tree is rooted to ‘Ca. Phytoplasma asteris’ (Aster yellows phytoplasma; GenBank no. AF222063). Bootstrap values above 50 % are shown (1000 replications). The circle, triangle and square represent Omani, UAE and Iranian isolates, respectively

The primer pair SecAfor2/SecArev3 resulted in a product of 482 bp in size for the 57 strains analyzed (Table 1). Analysis of secA sequences showed that all strains share 99.8–100 % sequence similarity to each other and to the secA sequence of lime witches’ broom phytoplasma (Accession number: EU168731, Oman). Based on the SecA phylogenetic tree, ‘Candidatus Phytoplasma aurantifolia’ isolates were separated from 9 other phytoplasmas with a very high bootstrap support (Fig. 3). Analysis of genetic divergence among the 57 ‘Ca. P. aurantifolia’ based on secA gene sequences showed that the range of divergence is 0-0.010 among Omani strains, 0–0.004 among the UAE strains and 0-0.006 among the Iranian strains (Table 3). The overall sequence divergence in the secA genes from all ‘Ca. P. aurantifolia’ isolates of this study and the reference strains was 0.000–0.015 (avg. 0.003).
Table 1

Primers used for amplifying Phytoplasma genes

Gene

Primer name

5′-3′ Sequence

Product size (bp)

References

16S rRNA

P1

AAGAGTTTGATCCTGGCTCAGGATT

1784

Deng and Hiruki (1991)

 

P7

CGTCCTTCATCGGCTCTT

  
 

R16R2

GAAACGACTGCTAAGACTGG

~1248

Gundersen and Lee (1996)

 

R16F2n

TGACGGGTGTGTACAAACCCCG

  

SecA

SecAfor1

GARATGAAAACTGGRGAAGG

482a

Hodgetts et al. (2008)

 

SecAfor2

GAYGARGSWAGAACKCCT

  
 

SecArev3

GTTTTRGCAGTTCCTGTCATNCC

  

imp

ImpF

ATGAATCACAAAGAAATTTTTTAC

519

Siampour et al. (2012)

 

ImpR

TTATGATAATTTTAAATCTG

  

aUsing SecAfor2/SecArev3 primer combinations in a semi-nested PCR (Hodgetts et al. 2008)

Fig. 3

A phylogenetic tree showing analysis of 57 phytoplasma isolates from Oman, the UAE and Iran with 10 secA reference sequences of all representative phytoplasmas available in GenBank (phytoplasma sequences with less than 95 % query coverage were excluded). Bootstrap values above 50 % are shown (1000 replications). The circle, triangle and square symbols represent Omani, UAE and Iranian isolates, respectively

PCR amplification using the primer pair ImpF/ImpR, produced a fragment of 519 bp (Table 1). Analysis based on the imp gene sequences showed that 55 phytoplasmas share 100 % sequence similarity to each other and to lime witches’ broom phytoplasma (Accession number: GU339497, Iran), while they were found to share 99.8 % similarity to strains 8 and 9 from Oman (Table 2). Phylogenetic analysis based on the imp gene sequences showed that all ‘Ca. Phytoplasma aurantifolia’ isolates were separated with a high bootstrap support from 16 other phytoplasmas (Fig. 4). The genetic divergence among the 57 sequences ranged from 0 to 0.002 for the Omani strains, while there was no divergence among the Iranian and UAE strains (Table 3). The overall sequence divergence in the imp genes from all ‘Ca. P. aurantifolia’ isolates of this study and the reference strains was 0.000–0.015 (avg. 0.003).
Table 2

Characteristics of samples collected from Oman, UAE and Iran

No.

Sample code

Country

Governorate/province

Year of collection

GenBank accession numbers

16S rRNA

secA

imp

1

Iran 1

Iran

Hormozgan

2013

LN872963

LN873084

LN873020

2

Iran 2

Iran

Hormozgan

2013

LN872966

LN873087

LN873023

3

Iran 3

Iran

Hormozgan

2013

LN872969

LN873090

LN873026

4

Iran 4

Iran

Hormozgan

2013

LN872972

LN873093

LN873029

5

Iran 5

Iran

Hormozgan

2013

LN872975

LN873096

LN873032

6

Iran 6

Iran

Kerman

2013

LN872978

LN873099

LN873035

7

Iran 7

Iran

Kerman

2013

LN872981

LN873102

LN873038

8

Iran 8

Iran

Kerman

2013

LN872984

LN873105

LN873041

9

Iran 9

Iran

Kerman

2013

LN872986

LN873107

LN873043

10

Iran 10

Iran

Hormozgan

2013

LN872989

LN873110

LN873046

11

UAE 1

UAE

Al-Ain

2013

LN872965

LN873086

LN873022

12

UAE 2

UAE

Al-Ain

2013

LN872968

LN873089

LN873025

13

UAE 3

UAE

Al-Ain

2013

LN872971

LN873092

LN873028

14

UAE 4

UAE

Al-Ain

2013

LN872974

LN873095

LN873031

15

UAE 5

UAE

Al-Ain

2013

LN872977

LN873098

LN873034

16

UAE 6

UAE

Al-Ain

2013

LN872980

LN873101

LN873037

17

UAE 7

UAE

Al-Ain

2013

LN872983

LN873104

LN873040

18

UAE 9

UAE

Al-Ain

2013

LN872988

LN873109

LN873045

19

UAE 10

UAE

Al-Ain

2013

LN872991

LN873112

LN873048

20

Oman 1

Oman

Musandam

2013

LN872964

LN873085

LN873021

21

Oman 2

Oman

Musandam

2013

LN872967

LN873088

LN873024

22

Oman 3

Oman

Musandam

2013

LN872970

LN873091

LN873027

23

Oman 4

Oman

Musandam

2013

LN872973

LN873094

LN873030

24

Oman 5

Oman

Musandam

2013

LN872976

LN873097

LN873033

25

Oman 6

Oman

Musandam

2013

LN872979

LN873100

LN873036

26

Oman 7

Oman

Musandam

2013

LN872982

LN873103

LN873039

27

Oman 8

Oman

Musandam

2013

LN872985

LN873106

LN873042

28

Oman 9

Oman

Musandam

2013

LN872987

LN873108

LN873044

29

Oman 10

Oman

Batinah

2014

LN872990

LN873111

LN873047

30

Oman 11

Oman

Batinah

2014

LN872992

LN873113

LN873049

31

Oman 12

Oman

Batinah

2014

LN872993

LN873114

LN873050

32

Oman 13

Oman

Batinah

2014

LN872994

LN873115

LN873051

33

Oman 14

Oman

Batinah

2014

LN872995

LN873116

LN873052

34

Oman 15

Oman

Batinah

2014

LN872996

LN873117

LN873053

35

Oman 16

Oman

Batinah

2014

LN872997

LN873118

LN873054

36

Oman 17

Oman

Batinah

2014

LN872998

LN873119

LN873055

37

Oman 18

Oman

Batinah

2014

LN872999

LN873120

LN873056

38

Oman 19

Oman

Batinah

2014

LN873000

LN873121

LN873057

39

Oman 20

Oman

Batinah

2014

LN873001

LN873122

LN873058

40

Oman 21

Oman

Batinah

2014

LN873002

LN873123

LN873059

41

Oman 22

Oman

Batinah

2014

LN873003

LN873124

LN873060

42

Oman 23

Oman

Batinah

2014

LN873004

LN873125

LN873061

43

Oman 24

Oman

Batinah

2014

LN873005

LN873126

LN873062

44

Oman 25

Oman

Batinah

2014

LN873006

LN873127

LN873063

45

Oman 26

Oman

Batinah

2014

LN873007

LN873128

LN873064

46

Oman 27

Oman

Dakhlia

2014

LN873008

LN873129

LN873065

47

Oman 28

Oman

Dakhlia

2014

LN873009

LN873130

LN873066

48

Oman 29

Oman

Dakhlia

2014

LN873010

LN873131

LN873067

49

Oman 30

Oman

Dakhlia

2014

LN873011

LN873132

LN873068

50

Oman 31

Oman

Dakhlia

2014

LN873012

LN873133

LN873069

51

Oman 32

Oman

Dakhlia

2014

LN873013

LN873077

LN873070

52

Oman 34

Oman

Dhahira

2014

LN873014

LN873078

LN873071

53

Oman 35

Oman

Dhahira

2014

LN873015

LN873079

LN873072

54

Oman 36

Oman

Dhahira

2014

LN873016

LN873080

LN873073

55

Oman 37

Oman

Dhahira

2014

LN873017

LN873081

LN873074

56

Oman 38

Oman

Dhahira

2014

LN873018

LN873082

LN873075

57

Oman 39

Oman

Dhahira

2014

LN873019

LN873083

LN873076

Fig. 4

Phylogenetic analysis of 57 phytoplasma isolates from Oman, the UAE and Iran with 17 imp reference sequences of all representative phytoplasmas available in GenBank. Bootstrap values above 50 % are shown (1000 replications). The circle, triangle and square symbols represent Omani, UAE and Iranian isolates, respectively

Table 3

Estimation of evolutionary divergence among phytoplasma sequences

 

Iran

UAE

Oman

16S rDNA

imp

secA

16S rDNA

imp

secA

16S rDNA

imp

secA

Mini

0.000

0.000

0.000

0.000

0.00

0.000

0.000

0.000

0.000

Max

0.002

0.000

0.006

0.002

0.00

0.004

0.003

0.002

0.010

Avg.

0.000

0.000

0.002

0.001

0.00

0.001

0.001

0.000

0.003

The table provides estimates of evolutionary divergence over sequence pairs within phytoplasma groups from the different countries. The analysis involved 57 nucleotide sequences. Analyses were conducted using the Kimura 2-parameter model (Mega 6)

Concatenated sequence analysis of phytoplasma genes

Phylogenetic analysis of the 57 strains based on the concatenated sequence of the 16S rRNA, secA and imp genes (2239 bp) showed clustering of most strains from Oman, the UAE and Iran. There was no relationship between clustering of the strains and the countries of origin or the regions in which they were collected (Fig. 5). The overall divergence among and within the Omani, Iranian and UAE sub-populations was found to be 0.001.
Fig. 5

UPGMA tree showing the analysis of 57 phytoplasma strains from Oman, the UAE and Iran based on the concatenated sequences of 16S rRNA, secA and imp genes. The total length of the concatenated sequences is 2239. GenBank accession numbers for the three genes of the 57 strains are listed in Table 1. The tree was prepared based on the matrix of pairwise distances using the Kimura 2 parameter evolutionary model. Bootstrap values above 50 % are shown (1000 replications). All positions containing gaps and missing data were eliminated. The units indicate the number of base substitutions per site

Discussion

Witches’ broom disease symptoms were observed in all the surveyed regions in Oman, UAE and Iran. Analysis of diversity among 57 phytoplasmas from Oman, UAE and Iran based on sequences of the 16S RNA gene showed that all share a high level of nucleotide similarity (mean: 99.7 %).

Previous studies detected limited variation in the 16S rRNA gene sequences among phytoplasma strains belonging to the same group (Bertaccini and Duduk 2009). The findings of this survey indicated the existence of a limited variation among ‘Ca. P. aurantifolia’ strains from Oman, UAE and Iran, not only based on the 16S rRNA gene, but also on secA and imp genes. None of the sequence of the three genes separated strains based on the country from which they were obtained. This finding, together with the overall low level of genetic divergence, may indicate that phytoplasma strains from the three countries have the same origin and could have been moved among the three countries via infected propagation material (Al-Sadi et al. 2012b). It is therefore important to inspect propagative material of acid lime for phytoplasma infection using appropriate detection tools (Duduk et al. 2013; Al-Sadi et al. 2012b). Trade is very active among the three countries and the exchange of agricultural material and products is very common owing to globalized market (Al-Sadi et al. 2012a, 2013). It is possible that the phytoplasma moved from the northern part of Oman to the UAE due to trade activities and germplasm exchange between families living on either side of the countries’ borders. In addition, the active trade between the northern part of Oman and the southern part of Iran could have contributed to moving infected material between the two countries. Additionally, the insect vector of WBDL (Hishimonas phycitis) and its close relationship with lime (or with some other citrus plants) may have provided a unique and narrow ecological niche for the WBDL phytoplasma resulting in its low genetic divergence.

Analysis of divergence among 57 isolates from the three countries showed that imp is highly conserved compared to the 16S rRNA and secA genes. Siampour et al. (2012) reported variation based on the imp gene and the presence of three differentiable subgroups when 18 ‘Ca. P. aurantifolia’-related strains were analyzed (imp-A, imp-B and imp-C). In their study, the strains were obtained from a range of different host plant species such as alfalfa, tomato, eggplant, carrot, periwinkle, pear, peanut and others, together with only one samples from lime (Siampour et al. 2012). The very low variability of the imp gene found in this work is in agreement with imp gene reported feature as a phytoplasma gene subjected to positive environmental selection (Kakizawa et al. 2009). It also indirectly confirms the possible spreading mainly through propagation materials (Al-Sadi et al. 2012b). SecA gene has been reported to give high resolution among the different ribosomal groups (Bekele et al. 2011), however also in this gene sequences a very low level of divergence among phytoplasma strains was detected.

Conclusion

The genetic diversity of ‘Ca. P. aurantifolia’ in Oman, UAE and Iran was analyzed for the first time based on three genes (16S rRNA, imp and secA). Data provided evidence of low genetic diversity among all strains based on analysis of the three genes. Future studies should target the association of other ‘Ca. P. aurantifolia’ genes with geographical locations and any symptoms that are not typical of WBDL.

Methods

Survey and collection of samples

Acid lime leaf samples were collected in Oman, UAE and Iran from trees with typical WBDL symptoms (Figs. 1, 6). Samples were collected over November 2013 to March 2014. Each sample consisted of at least 30 g of leaves which were kept in a plastic bag and stored in a cool box. All sampling details including location of the farm and age of trees were recorded.
Fig. 6

A map showing regions in Oman, the UAE and Iran from which samples were collected (indicated by bold circles)

In Oman, samples were collected from 4 governorates: Musandam, Batinah North, Dakhilya, and Dhahira (Fig. 6). At least 15 samples were collected from 5 farms in each governorate. Lime leaf samples were also collected from 6 farms in Al-Ain (UAE) in March 2013. In addition, samples were collected from Hormozgan and Kerman (Iran) (Fig. 6). At least 20 samples were collected from each country. All samples were labeled and transferred to Plant Pathology Research Laboratory, Sultan Qaboos University, where they were stored at −80 °C until used.

DNA extraction

Lime leaves were washed with tap water and disinfected by 70 % ethanol to remove contaminants. About 1 g of leaf midribs was ground using liquid nitrogen in sterilized mortars and pestles and DNA extraction was carried out by using DNeasy Plant Mini Kit (QIAGEN, GmbH, Hilden, Germany) according to manufacturer’s instructions.

Polymerase chain reaction (PCR)

Detection of phytoplasma in the samples was done using the universal primer pair P1 and P7 (Deng and Hiruki 1991; Schneider et al. 1995) (Table 1). PCR was done by using the following conditions: 94 °C for 30 s, then 35 cycles of 95 °C for 2 min, 53 °C for 60 s and 72 °C for 90 s, and final extension of 72 °C for 10 min (Sharmila et al. 2004). The reaction consisted of PuReTaq™ Ready-To-Go PCR™ beads (HVD Life Sciences, Vienna, Austria), 0.4 µM of each primer, ~25 ng DNA and sterilized distilled water up to 25 µl. Nested PCR using the primer pair R16R2 and R16F2n was carried out as described by Gundersen and Lee (1996). PCR products were separated on 1 % agarose gel in TBE buffer containing 1.5 µl of ethidium bromide and visualized under UV light.

The 57 DNA samples positive to phytoplasma were subjected to further PCR analysis to amplify secA gene by direct and semi-nested PCR assays using SecAfor1, SecAfor2, and SecArev3 as explained by Hodgetts et al. (2008). The conditions of PCR were 94 °C for 2 min followed by 35 cycles of 94 °C for 30 s, 53 °C for 60 s and 72 °C for 90 s and final extension of 72 °C for 15 min. First-round PCR product was diluted 1: 200 with sterilized distilled water and 1 µl of diluted product was used in semi-nested PCR using the primer pair SecAFor2/SecArev3 and the same reaction mixture and PCR conditions described above (Table 1). PCR products were separated as described above.

Amplification of imp gene was done using primers ImpF and ImpR as described by Siampour et al. (2012) (Table 1). The amplification and detection were carried out as described previously.

Sequence analysis

PCR products of the 16S rRNA, secA, and imp genes for the 57 samples collected from Oman, UAE and Iran were directly sequenced at Macrogen, Korea using the same primers employed for their amplification (Table 1). Sequences were aligned using Clustal-W program in Chromas Pro (version 1.41; Technelysium Pty Ltd, Brisbane, QLD, Australia). Construction of UPGMA tree was done based on the matrix of pairwise distances using the Kimura 2 parameter evolutionary model (Mega 6) (Tamura et al. 2013). Sequences of the 16S rRNA, secA and imp genes of reference strains of ‘Ca. Phytoplasma aurantifolia’ and phytoplasmas from other 16Sr groups obtained from National Center for Biotechnology Information (NCBI) were used for comparison with sequence from this study. Bootstrap consensus trees were generated based on 50 % majority-rule using 1000 replications. In addition, genetic divergence was calculated based on the number of base differences per sequence from averaging over all sequence pairs between groups and all ambiguous positions were removed for each sequence pair (Tamura et al. 2013).

Declarations

Authors’ contributions

Designed the experiments: AMA, MD, MSH, RS, RAY, AB; Performed the experiments: SYA, AMA, EAK. Analyzed the data: SYA, AMA, AB. Contributed reagents/materials: AMA. Wrote the manuscript: SYA, AMA, MD, MSH, RS, RAY, EAK, AB. All authors read and approved the final manuscript.

Acknowledgements

Authors would like to acknowledge Sultan Qaboos University and VALE Oman for the financial support of the study through the projects SR/AGR/CROP/13/01 and EG/AGR/CROP/12/02. Thanks are due to Abu Dhabi Food Control Authority (ADFCA) for support of the study in the UAE and to Issa Al-Mahmooli and growers in Oman, the UAE and Iran for their help in the collection of samples. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Royal Court Affairs
(2)
Department of Crop Sciences, College of Agricultural and Marine Sciences, Sultan Qaboos University
(3)
School of Biosciences, University of Nottingham
(4)
Abu Dhabi Food Control Authority
(5)
Islamic Azad University
(6)
Department of Agricultural Sciences, Plant Pathology, Alma Mater Studiorum-University of Bologna

References

  1. Al-Sadi AM, Al-Hilali SA, Al-Yahyai RA, Al-Said FA, Deadman ML, Al-Mahmooli IH, Nolasco G (2012a) Molecular characterization and potential sources of Citrus Tristeza Virus in Oman. Plant Pathol 61:632–640View ArticleGoogle Scholar
  2. Al-Sadi AM, Al-Moqbali H, Al-Yahyai R, Al-Said F, Al-Mahmooli I (2012b) AFLP data suggest a potential role for the low genetic diversity of acid lime (Citrus aurantifolia) in Oman in the outbreak of witches’ broom disease of lime. Euphytica 188:285–297View ArticleGoogle Scholar
  3. Al-Sadi AM, AL-Wehaibi AN, Al-Shariqi RM, Al-Hammadi MS, Al-Hosni IA, Al-Mahmooli IH, Al-Ghaithi AG (2013) Population genetic analysis reveals diversity in Lasiodiplodia species infecting date palm, Citrus, and mango in Oman and the UAE. Plant Dis 97:1363–1369View ArticleGoogle Scholar
  4. Al-Yahyai RA, Al-Sadi AM, Al-Said FA, Al-Kalbani Z, Carvalho CM, Elliot SL, Bertaccini A (2015) Development and morphological changes in leaves and branches of acid lime (Citrus aurantifolia) affected by witches’ broom disease. Phytopathol Meditteranea 54:133–139Google Scholar
  5. Bekele B, Abeysinghe S, Hoat TX, Hodgetts J, Dickinson M (2011) Development of specific secA-based diagnostics for the 16SrXI and 16SrXIV phytoplasmas of the Gramineae. Bull Insectol 64:15–16Google Scholar
  6. Bertaccini A, Duduk B (2009) Phytoplasma and phytoplasma diseases: a review of recent research. Phytopathol Mediterranea 48:355–378Google Scholar
  7. Bové JM, Garnier M, Mjeni AM, Khayrallah A (1988) Witches’ broom disease of small-fruited acid lime trees in Oman: first MLO disease of citrus. In: Proceedings of the 10th conference of the international organization of citrus virologists (IOCV). Riverside, pp 307–309Google Scholar
  8. Bové JM, Danet JL, Bananej K, Hassanzadeh N, Taghizadeh M, Salehi M, Garnier M (2000) Witches’ broom disease of lime (WBDL) in Iran. Fourteenth IOCV conference, insect-transmitted procaryotes, pp 207–212Google Scholar
  9. Chung KR, Khan IA, Brlansky RH (2006) Citrus diseases exotic to Florida: witches’ broom disease of lime (WBDL). EDIS Publications, University of Florida, Gainesville, pp 228:1–228:3Google Scholar
  10. Davies FS, Albrigo LG (1994) Citrus. CAB International, United KingdomGoogle Scholar
  11. Deng S, Hiruki C (1991) Amplification 16S rRNA genes from culturable and non-culturable mollicutes. J Microbiol Methods 14:53–61View ArticleGoogle Scholar
  12. Duduk B, Paltrinieri S, Lee IM, Bertaccini A (2013) Nested PCR and RFLP analysis based on the 16S rRNA gene. Methods Mol Biol (Clifton, NJ) 938:159–171Google Scholar
  13. FAOSTAT (2015) FAO. http://faostat3.fao.org/browse/rankings/countries_by_commodity/E. Accessed 2015
  14. Garnier M, Zreik L, Bové JM (1991) Witches’ broom, a lethal mycoplasmal disease of lime trees in the Sultanate of Oman and the United Arab Emirates. Plant Dis 75:546–551View ArticleGoogle Scholar
  15. Gundersen DE, Lee IM (1996) Ultrasensitive detection of phytoplasmas by nested PCR assay using two universal primer pairs. Phytopathol Mediterranea 35:144–151Google Scholar
  16. Hodgetts J, Boonham N, Mumford R, Harrison N, Dickinson M (2008) Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of ‘Candidatus Phytoplasma’. Int J Syst Evol Microbiol 58:1826–1837View ArticlePubMedGoogle Scholar
  17. Kakizawa S, Oshima K, Ishii Y, Hoshi A, Maejima K, Jung H-Y, Yamaji Y, Namba S (2009) Cloning of immunodominantmembrane protein genes of phytoplasmas and their in planta expression. FEMS Microbiol Lett 293:92–101View ArticlePubMedGoogle Scholar
  18. Schneider B, Seemüller E, Smart CD, Kirkpatrick BC (1995) Phylogenetic classification of plant pathogenic mycoplasmalike organisms or phytoplasmas. In: Raszin S, Tully JG (eds) Molecular and diagnostic procedures in mycoplasmology, vol 2. Academic Press, New York, pp 369–380View ArticleGoogle Scholar
  19. Sharmila LB, Bhasker S, Thelly MT, Edwin BT, Mohankumar C (2004) Cloning and sequencing of phytoplasma ribosomal DNA (rDNA) associated with kerala wilt disease of coconut palms. Plant Biochem Biotechnol 13:1–5View ArticleGoogle Scholar
  20. Siampour M, Izadpanah K, Galetto L, Salehi M, Marzachí C (2012) Molecular characterization, phylogenetic comparison and serological relationship of the Imp protein of several ‘Candidatus Phytoplasma aurantifolia’ strains. Plant Pathol 62:452–459View ArticleGoogle Scholar
  21. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729View ArticlePubMedPubMed CentralGoogle Scholar
  22. Zreik L, Carle P, Bové JM, Garnier M (1995) Characterization of the mycoplasma like organism associated with witches’ broom disease of lime and proposition of a ‘Candidatus’ taxon for the organism, ‘Candidatus Phytoplasma aurantifolia’. Int J Syst Bacteriol 45:449–453View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2016