Open Access

Molecular characterization of new described kobuvirus in dogs with diarrhea in China

SpringerPlus20165:2047

https://doi.org/10.1186/s40064-016-3738-4

Received: 31 March 2016

Accepted: 25 November 2016

Published: 30 November 2016

Abstract

Canine kobuvirus (CaKVs) was a newly described virus detected in dogs in the US and Italy. To learn more about CaKVs, 5 of 106 fecal samples from diarrhea dogs were positive with CaKVs in China, and the full genome of CaKVs strain CH-1 isolated from dog with diarrhea was sequenced. The genome consists of 8186 nucleotides, excluding the 3′ poly (A) tail, and an open reading frame that maps between nucleotide positions 601 and 7943 which encodes a 2446 amino acid polyprotein. Based on the complete amino acid sequence of polyprotein, phylogenetic analysis showed that CH-1 was grouped along with other canine kobuvirus strains detected in the USA (US-PC0082, AN211D).

Keywords

Molecular characterizationCanine kobuvirusPhylogenetic analysis

Background

Picornaviruses belonging to Picornaviridae family are small, nonenveloped viruses with a single-stranded positive-sense RNA genome encoding a single polyprotein, which is genetically highly diverse and infects a wide range of vertebrate species including human and animal. The Kobuvirus which was identified as a newly genus in the family Picornaviridae, consists of three species, Aichivirus A (formerly Aichi virus) (Yamashita et al. 1998), Aichivirus B (formerly Bovine kobuvirus) (Yamashita et al. 2003) and Aichivirus C (porcine kobuvirus) (Reuter et al. 2009). The species Aichivirus A consists of four types: Aichi virus 1, canine kobuvirus 1 (Kapoor et al. 2011; Li et al. 2011), feline kobuvirus 1 (Chung et al. 2013) and murine kobuvirus 1 (Phan et al. 2011). The species Aichivirus B consists of three types: bovine kobuvirus 1 (Yamashita et al. 2003), ferret kobuvirus 1 (Smits et al. 2013) and ovine kobuvirus (Reuter et al. 2010). The species Aichivirus C consists of a single type: porcine kobuvirus 1 (Reuter et al. 2008). Recently, a distinct group of kobuviruses, designated caprine kobuviruses (CKVs) was proposed as a new candidate species, Aichivirus D, within the genus Kobuvirus (Melegari et al. 2016; Oem et al. 2014). The host range of CaKV included four species in the canid species (domestic dog, red fox, golden jackal and side-striped jackal) and one non-canid species (spotted hyena, family Hyaenidae) (Di Martino et al. 2014; Olarte-Castillo et al. 2015). As companion animals, dog contacting with human frequently may be a potential intermediary to translate zoonotic virus. More recently, Canine kobuvirus have been recently discovered in dogs in USA, UK and Italy (Carmona-Vicente et al. 2013; Di Martino et al. 2013; Kapoor et al. 2011; Li et al. 2011). To extend these initial findings, we detected this newly characterized virus in stool samples from dogs with diarrhea in China, and sequenced the nearly complete genome of one isolate virus, CH-1.

Results and discussion

Out of 106 faecal samples, 5 (4.7%) were positive for the newly described CaKVs detected using reverse transcription-PCR (RT-PCR). Sequence analysis of the partial region, based on the 598-bp sequences, showed that the 5 sequences shared 98.3–99.8% identity with each other, suggesting that they could be considered members of the same virus species. The five sequences share 93–94% sequence identities with the CaKVs (CaKV/PC0082/US, CaKV/AN211D/US and CaKV/UK003/US) isolated from USA, respectively.

The complete genome of one strain CaKVs named CH-1, was detected and sequenced using 6 pair of primers designed basing on the genome of CaKV/AN211D/US (GenBank ID no. JN387133), which was 8186 nt and containing a partial 5′UTR of 601 nt, an open reading frame (ORF) with a length of 7341 nt encoding a putative polyprotein precursor of 2446 aa, and a 3′UTR of 244 nt (not containing poly A). The near-full genome of CH-1 shares a high G+C content (58.6%) with kobuviruses (52–59%).The putative polyprotein precursor encodes leader protein L (171 aa), capsid proteins VP0 (381 aa), VP3 (224 aa), VP1 (280 aa) and nonstructural proteins 2A (111 aa), 2B (165 aa), 2C (335 aa), 3A (94 aa), 3B (27 aa), 3C (390 aa) and 3D (269 aa) (Fig. 1a). The viral genome sequence described here has been deposited in the GenBank database and assigned accession no. JQ911763.
Fig. 1

a Genome organization of CaKV. b Phylogenetic tree was constructed by the neighbour-joining method with p-distances and 1000 bootstrap replicates using MEGA4.0 software (www. megasoftware.net) with an alignment of the complete amino acid sequence of polyprotein with known kobuviruses and kobu-like viruses. GenBank accession numbers are indicated. The isolate of CH-1 is marked with a square. Scale bar indicates estimated phylogenetic divergence

CH-1 showed 94% nucleotide identity with CaKVs genomes of US-PC0082 (JN088541), AN211D (JN387133) and UK003 (KC161964), respectively. Phylogenetic analysis using the complete polyprotein of CH-1 and 17 representative kobuvirus and related viruses was performed (Fig. 1b). In the tree, the strain CH-1 was grouped along with other canine kobuvirus strains identified in the USA (US-PC0082, AN211D). This finding showed that the newly described kobuvirus, CaKVs, might be widespread distribution in China.

Methods

This study was carried out in strict accordance with the recommendations in the guide for the care and use of laboratory animals by the authority of the People’s Republic of China. With approval from the animal ethics committee at Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences for the protocol (Permit Number: shvri-do-0330). During October 2010–April 2011, fecal samples were collected from 106 dogs with diarrhea in People’s Republic of China. Stool samples were suspended to 10% (wt/vol) in phosphate-buffered saline (0.01 M, pH7.4), and vigorously vortexed for 5 min. Two hundred microliters of supernatant was collected after centrifugation (5 min, 12,000g) for Extracting Viral nucleic acids using the QIAamp viral RNA extraction kit (Qiagen). Viral RNA was dissolved in 50 μL RNase-free water and stored at −80 °C.

Based on the kobuvirus genomes (GenBank No.JN387133), primers were designed for detecting the virus and cloning the full genomes of the viruses. Primers (CaKVs-L1 5′-ATACTTCACTGCCCAAACCC-3′, CaKVs-R1 5′-GAAGGTGAGTGGGGACAAGG-3′, CaKVs-L2 5′-AGACCGCGATTCCATCTGGA-3′ and CaKVs-R2 5′-GAGGTAGCGGGAGAAGATGT-3′) were used for reverse transcription nested PCR to detected CaKVs by amplification of a 598-bp fragment. The expected size DNA bands were excised from an agarose gel, purified with the AxyPrep DNA gel extraction kit (Axygen, Union City, CA, USA), cloned into pMD-18T vector (TaKaRa, Dalian, China), and sequenced (Applied Biosystems 3730 DNA Analyzer; Invitrogen).

The complete genome of CH-1, was detected and sequenced using 6 pair primers (Table 1) designed based on the Canine kobuvirus mRNA sequence (GenBank ID nos. JN387133) deposited in the GenBank database (NCBI) by polymerase chain reaction (PCR). The 5′ and 3′ ends of the CaKVs genome were amplified by the SMART RACE cDNA amplification kit (Clontech, China). PCR was performed using pfu DNA polymerase (Thermo Fisher Scientific). Each of the PCR products was sequenced and assembled using SeqMan software to obtain the full genome of CaKVs. The open reading frame (ORF) was identificated by Open Reading Frame Finder (ORF Finder) (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Multiple sequence alignment were performed using CLUSTALW software and phylogenetic trees were generated by the neighbor joining (NJ) method with bootstrap of 1000 replicates using MEGA 4.0 software.
Table 1

List of primers used in this study

Primer names

Sequence of primers (5′–3′)

Position (nt)

5′ race reverse-1

CAGTAGCAGTGATGTAGGTGAGGC

640

5′ race reverse-2

GCGGTAGAAAGAGTTCACAGTGG

618

5′ race reverse-3

CGCACAGAACGAGATTCCATT

593

3′ race forward-1

CGGGTTCGCTCCAAATTTC

7821

3′ race forward-2

TACCCTACTCCTACCTCCAACTCC

7841

3′ race forward-3

CGCTGGCTCAACCTGCTG

7864

1 forward

CCACTCTAATACCCCGAGGAAT

448

1 reverse

AGGTACGGTCACCGGAAGGT

1618

2 forward

CGAAGGAGCCGGGAAACT

1371

2 reverse

GGCAATCAGGACAGAGGTGG

3256

3 forward

ACTCTGCCCCCGCCTCTGCCCTCAT

2798

3 reverse

AGCCAAGTAAGGAAGGACACAAC

4328

4 forward

ACTGTACCCACTTTGTCCAAGGT

3911

4 reverse

AGTTCATCAGCGTAAGCTTCAGG

5609

5 forward

CCATGAACCCAACGAACGC

5238

5 reverse

CGATTTCGACTTGGAGTTCGG

6916

6 forward

CCATCAAGAAGGAACCGGC

6575

6 reverse

GTGGGTGGTCTTTATATCACCATG

7982

Conclusions

The present study showed that CaKVs were detected in fecal samples of dogs with diarrhea in China. Analysis the complete genome of one strain CaKVs named CH-1 found that CH-1 was grouped along with other canine kobuvirus strains detected in the USA (US-PC0082, AN211D). The epidemiologic surveillance and genome characterization of CaKVs might help clarify the global distribution and possible association of CaKVs with enteric diseases in dogs.

Declarations

Authors’ contributions

This work was carried out in collaboration between all authors. NK, YZ, ZW and TS carried out the genetic studies, participated in the sequence alignment and drafted the manuscript. TS and HY participated in the design of the study and performed the statistical analysis. EZ, GT and TS conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by National Natural Science Foundation of China (Grants 31201915 and 31201593) and the Shanghai Science and Technology Program for Agriculture (Grants 2013-5-5 and 2013-3-6).

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Department of Swine Infectious Disease, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences
(2)
Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses
(3)
Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Northwest A&F University

References

  1. Carmona-Vicente N, Buesa J, Brown PA, Merga JY, Darby AC, Stavisky J, Sadler L, Gaskell RM, Dawson S, Radford AD (2013) Phylogeny and prevalence of kobuviruses in dogs and cats in the UK. Vet Microbiol 164:246–252View ArticleGoogle Scholar
  2. Chung JY, Kim SH, Kim YH, Lee MH, Lee KK, Oem JK (2013) Detection and genetic characterization of feline kobuviruses. Virus Genes 47:559–562View ArticleGoogle Scholar
  3. Di Martino B, Di Felice E, Ceci C, Di Profio F, Marsilio F (2013) Canine kobuviruses in diarrhoeic dogs in Italy. Vet Microbiol 166:246–249View ArticleGoogle Scholar
  4. Di Martino B, Di Profio F, Melegari I, Robetto S, Di Felice E, Orusa R, Marsilio F (2014) Molecular evidence of kobuviruses in free-ranging red foxes (Vulpes vulpes). Arch Virol 159:1803–1806View ArticleGoogle Scholar
  5. Kapoor A, Simmonds P, Dubovi EJ, Qaisar N, Henriquez JA, Medina J, Shields S, Lipkin WI (2011) Characterization of a canine homolog of human Aichivirus. J Virol 85:11520–11525View ArticleGoogle Scholar
  6. Li L, Pesavento PA, Shan T, Leutenegger CM, Wang C, Delwart E (2011) Viruses in diarrhoeic dogs include novel kobuviruses and sapoviruses. J Gen Virol 92:2534–2541View ArticleGoogle Scholar
  7. Melegari I, Di Profio F, Sarchese V, Martella V, Marsilio F, Di Martino B (2016) First molecular evidence of kobuviruses in goats in Italy. Arch Virol 161:3245–3248View ArticleGoogle Scholar
  8. Oem JK, Lee MH, Lee KK, An DJ (2014) Novel Kobuvirus species identified from black goat with diarrhea. Vet Microbiol 172:563–567View ArticleGoogle Scholar
  9. Olarte-Castillo XA, Heeger F, Mazzoni CJ, Greenwood AD, Fyumagwa R, Moehlman PD, Hofer H, East ML (2015) Molecular characterization of canine kobuvirus in wild carnivores and the domestic dog in Africa. Virology 477:89–97View ArticleGoogle Scholar
  10. Phan TG, Kapusinszky B, Wang C, Rose RK, Lipton HL, Delwart EL (2011) The fecal viral flora of wild rodents. PLoS Pathog 7:e1002218View ArticleGoogle Scholar
  11. Reuter G, Boldizsar A, Kiss I, Pankovics P (2008) Candidate new species of Kobuvirus in porcine hosts. Emerg Infect Dis 14:1968–1970View ArticleGoogle Scholar
  12. Reuter G, Boldizsar A, Pankovics P (2009) Complete nucleotide and amino acid sequences and genetic organization of porcine kobuvirus, a member of a new species in the genus Kobuvirus, family Picornaviridae. Arch Virol 154:101–108View ArticleGoogle Scholar
  13. Reuter G, Boros A, Pankovics P, Egyed L (2010) Kobuvirus in domestic sheep, Hungary. Emerg Infect Dis 16:869–870View ArticleGoogle Scholar
  14. Smits SL, Raj VS, Oduber MD, Schapendonk CM, Bodewes R, Provacia L, Stittelaar KJ, Osterhaus AD, Haagmans BL (2013) Metagenomic analysis of the ferret fecal viral flora. PLoS ONE 8:e71595View ArticleGoogle Scholar
  15. Yamashita T, Sakae K, Tsuzuki H, Suzuki Y, Ishikawa N, Takeda N, Miyamura T, Yamazaki S (1998) Complete nucleotide sequence and genetic organization of Aichi virus, a distinct member of the Picornaviridae associated with acute gastroenteritis in humans. J Virol 72:8408–8412Google Scholar
  16. Yamashita T, Ito M, Kabashima Y, Tsuzuki H, Fujiura A, Sakae K (2003) Isolation and characterization of a new species of kobuvirus associated with cattle. J Gen Virol 84:3069–3077View ArticleGoogle Scholar

Copyright

© The Author(s) 2016