Skip to main content

Advertisement

Table 1 List of primers used in this study

From: Molecular characterization of new described kobuvirus in dogs with diarrhea in China

Primer names Sequence of primers (5′–3′) Position (nt)
5′ race reverse-1 CAGTAGCAGTGATGTAGGTGAGGC 640
5′ race reverse-2 GCGGTAGAAAGAGTTCACAGTGG 618
5′ race reverse-3 CGCACAGAACGAGATTCCATT 593
3′ race forward-1 CGGGTTCGCTCCAAATTTC 7821
3′ race forward-2 TACCCTACTCCTACCTCCAACTCC 7841
3′ race forward-3 CGCTGGCTCAACCTGCTG 7864
1 forward CCACTCTAATACCCCGAGGAAT 448
1 reverse AGGTACGGTCACCGGAAGGT 1618
2 forward CGAAGGAGCCGGGAAACT 1371
2 reverse GGCAATCAGGACAGAGGTGG 3256
3 forward ACTCTGCCCCCGCCTCTGCCCTCAT 2798
3 reverse AGCCAAGTAAGGAAGGACACAAC 4328
4 forward ACTGTACCCACTTTGTCCAAGGT 3911
4 reverse AGTTCATCAGCGTAAGCTTCAGG 5609
5 forward CCATGAACCCAACGAACGC 5238
5 reverse CGATTTCGACTTGGAGTTCGG 6916
6 forward CCATCAAGAAGGAACCGGC 6575
6 reverse GTGGGTGGTCTTTATATCACCATG 7982