Open Access

Mining microsatellites in the peach genome: development of new long-core SSR markers for genetic analyses in five Prunus species

  • Maria Teresa Dettori1Email author,
  • Sabrina Micali1,
  • Jessica Giovinazzi1,
  • Simone Scalabrin2,
  • Ignazio Verde1 and
  • Guido Cipriani3
SpringerPlus20154:337

https://doi.org/10.1186/s40064-015-1098-0

Received: 6 March 2015

Accepted: 12 June 2015

Published: 10 July 2015

Abstract

A wide inventory of molecular markers is nowadays available for individual fingerprinting. Microsatellites, or simple sequence repeats (SSRs), play a relevant role due to their relatively ease of use, their abundance in the plant genomes, and their co-dominant nature, together with the availability of primer sequences in many important agricultural crops. Microsatellites with long-core motifs are more easily scored and were adopted long ago in human genetics but they were developed only in few crops, and Prunus species are not among them. In the present work the peach whole-genome sequence was used to select 216 SSRs containing long-core motifs with tri-, tetra- and penta-nucleotide repeats. Microsatellite primer pairs were designed and tested for polymorphism in the five diploid Prunus species of economic relevance (almond, apricot, Japanese plum, peach and sweet cherry). A set of 26 microsatellite markers covering all the eight chromosomes, was also selected and used in the molecular characterization, population genetics and structure analyses of a representative sample of the five diploid Prunus species, assessing their transportability and effectiveness. The combined probability of identity between two random individuals for the whole set of 26 SSRs was quite low, ranging from 2.30 × 10−7 in peach to 9.48 × 10−10 in almond, confirming the usefulness of the proposed set for fingerprinting analyses in Prunus species.

Keywords

P. armeniaca P avium P. persica P. salicina P. dulcis Fingerprinting

Background

The Prunus genus includes several diploid species of economic relevance. Comparative mapping studies showed that the genomes of the diploid Prunus species are essentially colinear and syntenic (Dettori et al. 2001; Dirlewanger et al. 2004; Verde et al. 2005; Dondini et al. 2007; Jung et al. 2009) and DNA fingerprinting of accessions belonging to these species consistently revealed a high transportability of molecular markers (Cipriani et al. 1999; Dirlewanger et al. 2002; Vendramin et al. 2007). Fingerprinting based on molecular markers is a popular tool for studies of population genetics and diversity, including the resolution of synonymy/homonymy controversies, the protection of plant breeders’ rights, paternity and kinship analyses.

SSR markers (simple sequence repeats), or microsatellites, consist of tandemly repeated DNA sequences with a core unit of 1–6 base pairs (bp). They offer a number of positive features for the genetic profiling of individuals including wide distribution in plant genomes, prevalent single-locus tagging in diploid species, multi-allelic co-dominant patterns, simple use and availability of several primer sequences in many important agricultural crops (Schlötterer 2004). The high variability of microsatellites is mainly due to a different number of repeats in the region of the repeated motif but also to short insertion/deletion events (Decroocq et al. 2003).

In humans and animals long nucleotide repeats, namely tetra- and penta- motifs, were adopted because neighbor alleles are more easily separated from each other (Hammond et al. 1994; Ruitberg et al. 2001; Butler et al. 2004; Butler 2006; Hellmann et al. 2006). Moreover, di-nucleotide SSRs, even though frequent in eukaryotic genomes, suffer from the presence of ghost bands (stuttering), which make the interpretation of electropherograms and the allele call less reliable.

The first SSRs developed by plant scientists were mainly di-nucleotide repeats, which are the most abundant in plant genomes. The isolation procedure was costly, microsatellites were isolated from SSR-enriched libraries with the aim of producing a high number of potentially useful markers for mapping purposes. The availability of whole-genome sequences offers the opportunity to mine the genomes and retrieve thousands of different kind of markers including single nucleotide polymorphisms (SNPs), structural variants and microsatellites.

SNPs are widely used for the generation of saturated genetic maps due to the availability of high-throughput automated genotyping platforms (Gunderson 2009). High-throughput SNP tools have been recently developed in Prunus species using an Illumina platform (Peace et al. 2012; Verde et al. 2012) and have been used to genotype cultivars and accessions to perform large scale genetic analyses (Micheletti et al. 2012). However, mapping technologies using SNP markers are still rather expensive and not applicable in every laboratory.

Due to their relative abundance in the genome and simple relatively low cost detection, microsatellites are still preferable in population genetics and fingerprinting studies with a low or moderate number of markers. As the regions flanking the repeated motif are in many cases highly conserved, microsatellite markers are easily amplified by PCR in many different accessions and close species. Long-core repeats microsatellites have been developed in a few tree species: grape (Cipriani et al. 2008, 2010), Eucalyptus (Faria et al. 2011) and olive (De la Rosa et al. 2013).

The availability of the peach genome sequence (Verde et al. 2013) has allowed the scanning of the whole genome with the aim of retrieving microsatellites to be used for molecular analyses in peach and in its closely related species belonging to the Prunus genus.

The aim of this study was to find a universal set of polymorphic tri-, tetra- or penta-nucleotide SSRs distributed in the eight chromosomes for the following diploid Prunus species: peach (P. persica), almond (P. dulcis), apricot (P. armeniaca), Japanese plum (P. salicina), sweet cherry (P. avium). These SSRs were also required to preferably be single locus and to have common amplification parameters.

Methods

Retrieving microsatellites from the peach genome sequence

Penta-, tetra- tri- and di-nucleotide core simple sequence repeats with a minimum length of 12 bp were retrieved from the peach whole-genome sequence (Peach v1.0; Verde et al. 2013) available at the Phytozome web site (http://www.phytozome.net/peach; Goodstein et al. 2012). A modified version of the software Sputnik (Abajian 1994) with the default parameters was used. Microsatellite sequences were scanned in each one of the eight pseudomolecules of the genome assembly (scaffolds 1–8), representing the eight Prunus chromosomes and containing up to 96% of the total peach sequence (Verde et al. 2013).

The final goal was to select a useful set of well-distributed markers, at least two for each chromosome. To improve polymorphism detection rate we chose to consider only microsatellites longer than 19 bp. Within each pseudochromosome, SSRs were chosen giving preference to those located towards the ends to ensure marker independence. Each microsatellite-containing sequence was aligned against the peach genome dataset through the BLASTn algorithm available at the Phytozome website to check adjacent regions; microsatellites falling within or close to repetitive regions were excluded. Primers were designed for the selected SSR loci using Primer 3 software (http://bioinfo.ut.ee/primer3-0.4.0/primer3/) and were subjected to BLASTn analysis against the Peach v1.0 to discard those targeting multiple loci. The parameters for primer design were as follows: amplicon size 150–300 bp, primer size 18–24 bp, primer melting temperature of 56–58°C with an optimum at 57°C, max self-complementarity 3 or 4 (3 preferred) and max 3′ self-complementarity 1 or 2 (1 preferred).

Preliminary PCR primer testing

Preliminary PCR amplifications were performed for each designed marker in a panel of the five Prunus diploid species. In total 24 accessions were used as follows: eight peaches, eight cherries, three Japanese plums, three almonds and two apricots. The final number of microsatellites was thus achieved in a stepwise procedure of selection and testing until a minimum number of efficient primers for a given chromosome was reached.

Young leaves were collected from plants at the germplasm collection field of the CRA Centro di Ricerca per la Frutticoltura—Rome (Centro Nazionale Germoplasma Frutticolo—CNGF), frozen in liquid nitrogen and stored at −80°C until freeze dried. DNA was extracted using the Qiagen DNeasy Plant Mini Kit, following the manufacturer’s instructions. PCR reactions were carried out in a volume of 10 μL with a final concentration of 200 μM of each dNTP and 0.1 μM of each primer, 10 ng genomic DNA, and 0.5U of Platinum®Taq DNA Polymerase (Invitrogen). An Applied Biosystem Verity thermal cycler was used with the following thermal profile: one cycle at 94°C for 5 min, followed by 10 touch down cycles at 94°C for 30 s, the primer specific Tm°C—0.5°C/cycle for 45 s, 72°C for 60 s, followed by 25 cycles at 94°C for 30 s, Ta°C for 45 s, 72°C for 60 s, and a final step of 30 min at 72°C. The annealing temperature of each primer pair is reported in Additional file 1: Table S1. Amplicons were separated in a 3% MetaPhor™ Agarose (Lonza) gel in TBE 1 × buffer and scored, after GelRed™ staining, for the presence of bands.

PCR primer testing

Primers polymorphic in at least three different species were re-tested on a total of 18 cultivars for each species (Table 1), chosen on the basis of previous fingerprinting studies with the aim of maximizing genetic diversity. DNA samples were amplified as explained above, but using WellRED forward primers (0.075 µM) labeled with D2-PA, D3-PA and D4-PA (Sigma-Aldrich) fluorescent dyes. D3-PA- and D4-PA-labeled PCR products were diluted 1:5 and 1:9, respectively, in ddH2O, while D2-PA-labeled amplicons were left undiluted. One microliter from each of the three PCR reactions was analyzed in multiplex, by adding 0.5 µl of CEQ DNA size Standard kit 400 (Beckman Coulter) and 36.5 µl of CEQ sample loading solution for a total of 40 µl. Amplicons were separated by capillary electrophoresis, performed on a CEQ8000 DNA Analysis System (Beckman Coulter).
Table 1

The 90 accessions belonging to the five Prunus species used to test the long-core repeat primer pairs selected in the peach genome

Species

Cultivar/accession

Pedigree

Species

Cultivar/accession

Pedigree

Almond

Cavaliera

Peach

Alexandra

Noblesse op

Cristomorto

Babygold 8

Pl35201 × Ambergem

Desmayo Largueta

Catherina

NJC95 × D42-13 W

Desmayo Rojo

Duchessa d’Este

(Mayflower × Amsden) op

Ferraduel

Cristomorto × Aï

Elberta

Chinese Cling op or Chinese Cling × Early Crawford

Ferragnes

Cristomorto × Aï

Fantasia

GoldKing × Red King op

Genco

Ferganensis

Glorieta

Primorskii × Cristomorto

Gialla di Verona

Malaguena

Maruja

Marcona

Maycrest

Springcrest mutant

Masbovera

Primoskii × Cristomorto

Oro A

Diamante op

Moncayo

Tardive de la Verdiere × Tuono

Quetta

Nonpareil

Redhaven

Halehaven × Kalhaven

Pizzuta d’Avola

Royal Moon

Primorskii

Sahua Hong Pantao

Retsou

Shenzhou Mitao

Texas

Ferragnès × Tuono

Snow Queen

Tuono

Yumyeong

Yamato-Wase × Nunome Wase

Apricot

Bergeron

Sweet cherry

Adriana

ISF 123 × Mora di Cazzano

Bulida

Bianca di Aritzo

Castelbrite

Burlat

Seedling (unknown origin)

Comédie

Bergeron × Rouge de Roussillon

Casanova

Currots

Durone nero II

Dany

Ferrovia spur

Ferrovia mutant

Helena

Isabella

Starking Hardy Giant × Stella

Lady Rose

Kasthanka

Magyar Kajszi

Hungarian Best

Kavics

Germersdorfi orias 92 × Budakalasz

Ninfa

Ouardi × Tyrinthos

Lambert

Palstein

Lapins

Van × Stella

Pinkot

Linda

S. Castrese

Pagliaccio

Stella

Rainier

Bing × Van

Goldrich

SunGlo × Perfection

Schneider Späte Knorpel

Tardive de Bordaneil

Stella

Lambert × Jhon Innes

Tyrinthos

Sunburst

Van × Stella

Vicario

Van

Imperatrice Eugenie op

Japanese plum

Angeleno

Queen Anne op

   

Black Diamond

   

Black Star

   

Friar

Gaviota × Nubiana

   

Golden Kiss

   

Laetitia

   

Larry Ann

   

Methley

   

Obilnaya

   

Oishi Nakate

   

Queen Rosa

Santa Rosa × Queen Anne

   

Sangue di Drago

   

Santa Rosa

   

September Giant

   

T.C. Sun

   

Tracy Sun

   

Weeping Santa Rosa

   

Yummy Beaut

   

Data analysis

SSRs were analyzed with the fragment analysis tool of the software CEQ Genetic Analysis System v 8.0 (Beckman Coulter). Genotypes showing a single peak at a given locus were recorded as homozygous. Single locus allelic data were used for population genetic parameters and stratification estimates. Cervus 3.0.6 (Kalinowski et al. 2007) was used for the calculation of allele frequency, observed and expected heterozygosity (Ho and He, respectively), the polymorphic information content (PIC), which measures the marker locus informativeness in relation to the expected heterozygosity, and the probability of identity, defined as the probability of two unrelated individuals sharing the same genetic profile by chance (NE-I). Frequencies of null alleles were calculated using the IIM (Individual Inbreeding Model) Bayesian approach implemented in the INEST software (Chybicki and Burczyk 2009) setting the cycles to 500,000 and the thinning parameter to 8,000. In order to define the best model fitting the data, the deviance information criterion (DIC) tool, available in the advanced 2.0v of the software, was computed both under the complete set of parameters (nfb model—simultaneous presence of null alleles, inbreeding and random amplification failure) and without inbreeding (nb model). A permutation test was also performed to estimate heterozygosity excess based on the inbreeding coefficient estimates (FIS = 1 − Ho/He) and a 95% confidence interval of the null distribution of F was obtained after 1,000,000 random permutations of all alleles among genotypes.

The ability of the microsatellite set to reveal population structure was evaluated using the model-based clustering method implemented in the software Structure 2.3.4 (Pritchard et al. 2000). For each species analyses were performed for K ranging from one to nine for ten independent replications under the admixture model with no prior population information. Tests were carried out applying a burn-in period of 75,000 followed by 200,000 Monte Carlo Markov chain (MCMC) iterations. The true number of K was chosen applying the Evanno method (Evanno et al. 2005) implemented in the online software Harvester (Earl and vonHoldt 2012); the software CLUMPP v. 1.1.2 (Jakobsson and Rosenberg 2007) was used, employing the full search algorithm, to find the optimal alignment of the ten independent replicate cluster analyses and to compute the mean membership coefficient matrix (Q-matrix). This matrix was entered into DISTRUCT v1.1 (Rosenberg 2004) to obtain an ordered graphical display of the population structure.

Relations among entries were analyzed using the software DARwin v 6.0 (Perrier and Jacquemoud-Collet 2006) scoring the data as presence/absence to include multilocus alleles. The dissimilarity matrix between accessions was calculated using the Dice index and the UPGMA tree was constructed using the hierarchical clustering method.

The newly developed markers were also compared with long core microsatellites already published to check for locus uniqueness.

Results and discussion

Selection of microsatellites

The primary aim of this study was to produce a set of long-core repeat SSR markers suitable for genetic analysis and genotyping in five different species of Prunus (almond, apricot, Japanese plum, peach and sweet cherry).

A total of 63,145 microsatellites carrying di-, tri-, tetra- and penta-nucleotide repeats were recovered from the peach genome sequence assembly (Peach v1.0;Verde et al. 2013). Di-nucleotide microsatellites were the most frequent in the peach genome (48.2%) followed by penta- (22.8%), tetra- (14.7%) and tri-nucleotide (14.3%) core motif microsatellites (Table 2). Microsatellites were arbitrarily divided into two classes: class I consists of perfect core repeats with more than 19 bp and class II consists of 12–19 bp long repeats (Table 2). The two class sizes were chosen following the classification already adopted in rice (Temnykh et al. 2001). The number of perfect microsatellites assigned to the two classes was 32,038 (50.7%) and 31,107 (49.3%), respectively. Within Class I long-core motifs, penta-nucleotide microsatellites were confirmed to be the most represented in the peach genome (13%), followed by those with repeats three (10%) and four (8%) nucleotides long. The relative abundance of the three types of long-core microsatellites found in our study is different from that described by Shi et al. (2013) scanning the same Prunus persica genome assembly dataset with a different computer program. However, this is not surprising as in several species (human, Saccharomyces cerevisiae, Neurospora crassa and Drosophila melanogaster) the distribution of microsatellites found within the genome was greatly variable in relation to different parameter settings and to the algorithm used for microsatellite detection (Leclercq et al. 2007).
Table 2

Repeats retrieved from the peach genome sequence

SSR Type

Classa

N. loci

Total length (bp)

Reference genome (%)b

SSR length

Min

Max

Dinucleotide

I

21,964

740 830

0.33

20

306

 

II

8,503

137 806

0.06

14

18

 

Tot

30,467

878,636

0.39

14

306

Trinucleotide

I

3,198

87,378

0.04

21

390

 

II

5,819

93,459

0.04

15

18

 

Tot

9,017

180,837

0.08

15

390

Tetranucleotide

I

2,566

57,996

0.03

20

88

 

II

6,708

96,236

0.04

12

16

 

Tot

9,274

154,232

0.07

12

88

Pentanucleotide

I

4,310

97,620

0.04

20

200

 

II

10,077

151,155

0.07

15

15

 

Tot

14,387

248,775

0.11

14

200

Tot

Class I

32,038

983,824

0.43

20

390

 

Class II

31,107

478,656

0.21

12

18

 

Tot

63,145

1,462,480

0.64

12

390

aSSRs longer than 19 bp were assigned to class I, those in the range between 12 and 19 bp were assigned to class II.

bbased on 227,252,106 bp in peach v1.0.

Microsatellite distribution was homogeneous across the genome, with an average of one microsatellite every 3.5 kb (Class I and Class II) and minimal differences among the pseudomolecules.

Preliminary testing of the primers pairs

A total of 222 long-core repeat SSRs from the Peach v1.0 database was tested (Additional file 1: Table S1). Out of these selected sequences, 74 contained tri-nucleotide motifs, 67 tetra-nucleotide motifs, and 81 penta-nucleotide motifs (Additional file 1: Table S1).The largest number of microsatellites was selected from the peach chromosome 4 (ten, nine, and 20 tri-, tetra-, and penta-nucleotides, respectively), and the lowest number from chromosome 2 (six, five, and six tri-, tetra-, and penta-nucleotides, respectively). However, this distribution is not representative of the relative chromosome lengths or of the actual distribution of the microsatellites across the genome, but is likely due to a bias in the stepwise selection procedure.

Peach samples were amplified at 216 SSR loci; six primer pairs did not yield an amplicon in any of the five species, peach included, and were therefore excluded from subsequent analyses.

A survey of the microsatellites already available in peach, revealed that the vast majority has a dinucleotide motif. None of our 216 microsatellites targets the same locus as the long-core SSRs previously published.

One hundred eighty-eight primer pairs (87.0%) did amplify all the five species; the overall SSR cross-transportability value obtained in this study is quite high and is in agreement with those previously observed in the genus by Dirlewanger et al. (2002), and Vendramin et al. (2007), 75.6 and 95%, respectively. The latter and highest value was found in a set of SSRs developed from the transcriptome of peach fruit. Twenty-eight primers did not yield amplification in at least one species: four failed in two species, two in four species and 22 in one species (15 in sweet cherry). Of the 28 primers not amplifying in at least one species, as much as 21 failed in sweet cherry, which is the more phylogenetically distant from peach (Bortiri et al. 2006). As expected, all primers gave a product in peach, the species from which these SSRs had been selected. A search in the list of predicted protein-coding genes from the peach genome sequence (v1.0) detected 68 markers (31.5%) out of 216 in genic regions; the Peach v1.0 ID for the SSRs containing genes is reported in Additional file 1: Table S1. Differences in the rate of transportability across Prunus were observed between genic and intergenic SSRs; five (7.4%) genic SSRs did not amplify in one of the species analyzed while 23 (15.5%) intergenic SSRs did not amplify in at least one species (17 in one species, four in two species and two in four species).

The number of markers polymorphic in at least one species was 153 (70.8%) and the rate of polymorphism of the three types of SSRs was 75.0% in tri-nucleotides, 63.1% in tetra-nucleotides, 73.4% in penta-nucleotides. Ninety-seven primer pairs gave polymorphic patterns in almond (46.6%), 83 in Japanese plum (40.9%), 50 in apricot (24.6%), 45 in peach (21.0%) and 37 in sweet cherry (19.5%; Table 3). Only 21.0% of the SSRs were polymorphic in peach, the species from which the sequences containing the microsatellite regions had been selected. The lower level of variability of peach compared to the other four species found in the present work is well known (Byrne 1990; Mnejja et al. 2010) and is the result of many factors. Peach is in fact, the only self-compatible species of this work and self-pollination, leading to homozygosity, is predominant (Miller et al. 1989; Hegedüs et al. 2006). Moreover, it has undergone severe bottlenecks during domestication and diversification (Verde et al. 2013) and modern peach cultivars were established from a very narrow genetic pool (Scorza et al. 1985; Aranzana et al. 2010). The higher rate of polymorphism found in almond compared to the other species is expected considering that almond is an outcrossing self-incompatible species phylogenetically more strictly related to peach (Bortiri et al. 2006). The rate of polymorphism in almond, apricot and Japanese plum is likely to be underestimated due the lower number of samples analyzed respect to peach and cherry. Differences in polymorphism rates were observed between genic and intragenic markers: SSRs polymorphic in at least one species were 45 (66.2%) genic and 108 (73.0%) intragenic, while those polymorphic in all the species were 2 (2.9%) and 11 (7.4%), respectively. Considering the single species (Table 3) almond was the most polymorphic one having a rate of polymorphism of 42.4% for genic and 48.6% for intergenic SSRs. Cherry was the least polymorphic, with a rate of 14.3 and 22.0% in genic and intergenic regions, respectively.
Table 3

Distribution of 216 SSR markers between genic and intergenic regions and relative polymorphisms in the five Prunus species

 

Almond (n = 3)

Apricot (n = 2)

Japanese plum (n = 3)

Peach (n = 8)

Sweet cherry (n = 8)

tot scorable SSRs

208

204

204

214

190

tot polymorphic SSRs

97

50

83

45

37

% polymorphic SSRs

46.6

24.6

40.9

21.0

19.5

tot scorable genic SSRs

66

65

63

68

63

tot polymorphic genic SSRs

28

16

19

12

9

% polymorphic genic SSR

42.4

24.6

30.2

17.6

14.3

tot scorable intergenic SSRs

142

139

141

146

127

tot polymorphic intergenic SSRs

69

34

64

33

28

% polymorphic intergenic SSRs

48.6

24.5

45.4

22.6

22.0

n number of accessions used for testing.

Twenty-six of these 222 primer pairs met the criteria needed to enter the next step of analysis, the remaining being discarded due to one or more drawbacks such as weak amplification, unreadable multi-peak profiles, monomorphic profile and/or amplification failure in more than two species.

Evaluation of SSR profiles and polymorphism

The primer pair characteristics and the diversity parameters of the 26 long-core SSRs in each of the five Prunus species are listed in Tables 4 and 5, respectively. Thirteen primer pairs identified polymorphisms in all the species (Table 5), ten in four species and three in three species, respectively. At least one polymorphic marker was found for each chromosome in all the species.
Table 4

Characteristics of the 26 long-core repeat primer pairs selected for fingerprinting of the five Prunus species

SSR ID

Pseudochrom.

TA

(SSR motif)n

Primer Forward

Primer Reverse

Sequence

Peach v1.0 start

Sequence

Peach v1.0 start

RPPG1-017

1

56

(AGCTT)5

GCTCATCAAAACTCTCAACCA

2,785,626

CCCTTTCTTCAATCCCATC

2,785,848

RPPG1-026

1

51

(GAT)7

CTTCTGGCACTCTTCCATTT

4,980,754

GTTCCCAAGTTTTCCTCTCA

4,980,991

RPPG1-032

1

53

(CTT)7

ATGGCAGAGAGCACAACAA

22,022,341

TTGAGAGGTAACAGCGAGAA

22,022,564

RPPG1-037

1

53

(AGC)7

GTCTCTGATCCAAGCCAACT

42,186,590

ACGCTGCCATTGTTTCTATT

42,186,831

RPPG1-041

1

56

(ATT)7

TGTTGTAATGGATGGTGTCTTC

44,374,756

CTTGGTCTTGGTTTCATTCA

44,374,983

RPPG2-011

2

53

(ATTT)5

TTTACAGGTGCCTCAACAAA

3,728,089

GTACAGCCGATGGAGAGAAA

3,728,287

RPPG2-022

2

53

(CTGT)6

CTGCTGCGTCTGATGATG

26,576,155

ACAGGACAGGACCACTTTCT

26,576,364

RPPG3-026

3

53

(CTGT)6

AGAACGCTATTCCCCTGTAA

3,151,168

TCATCCTCTCCAAATGTCAA

3,151,412

RPPG4-059

4

56

(ACTGG)6

GACGGCTGTTTATTTGCATT

138,756

TGCATTTGTGATCTCGTTTC

138,937

RPPG4-067

4

58

(GGTTT)4

AGAAGGGAGGGTGAGAGAAG

3,564,871

CACGAAGGAAGAAACGAAGT

3,565,136

RPPG4-077

4

57

(AATT)5

CCTCGTCTTCAGTCTTTTCTG

18,611,275

CTGTCCCTTCTGTGTTCCTAA

18,611,433

RPPG4-084

4

58

(ATTT)5

TCCTCAAAAGTTACCCCAAG

26,137,915

CTTGCTGTGGAAGAAGAACC

26,138,190

RPPG4-091

4

49

(CTTTT)6

GGAGGGTAGAGAACAGAGCA

27,055,301

CGGAAGATGTGATTGTGAGA

27,055,542

RPPG5-018

5

56

(ATT)8

GCATGAAATTGACCCATACA

5,331,336

TAATTGCTTTGGGGAGGAC

5,331,523

RPPG5-022

5

58

(ATC)11

CTTGTGAACTGGCATCTGTC

8,805,836

AGTTGTATGGGCATGTTGTG

8,806,134

RPPG5-023

5

56

(ATT)7

TTGTTTGCACTAGGCTTTGA

16,625,324

TTCTTCTTGCATGTCCTTGA

16,625,517

RPPG5-025

5

53

(CCCTT)5

GTGTCTCCTCCTCAAAGCAA

16,792,568

TACGGCAACCAAGAACATC

16,792,866

RPPG5-030

5

53

(AATT)5

AAGGCAAGGAATTGGGTAGT

18,027,410

TGGTTTGTCGTAAGAGTCCA

18,027,575

RPPG6-009

6

53

(GTTTT)4

GGGCTTGGCTGATAAAATAA

1,068,427

TGGTAAAATAGAAGAGCGAGAAG

1,068,608

RPPG6-032

6

53

(ATCGC)5

TCCTATGGCAAAAACAAAATC

26,949,411

TGAAGAGATGGAGTGGAAGAG

26,949,563

RPPG6-033

6

56

(CTGT)6

CATTATCAAACCACGACCAA

27,071,911

AAAGCTCAACAGCGACTTCT

27,072,026

RPPG7-015

7

58

(ATTT)6

TCTTGGTGGTGGTGAAGTAA

2,533,650

GAGAGATGGAGGAGGCTGA

2,533,925

RPPG7-026

7

53

(ACATT)4

TTTGGTGAGTGGGCTCTATT

18,786,038

CTATCGTTCGCTGGTCTTCT

18,786,203

RPPG7-032

7

53

(AGG)7

AAGGGAGGAGGATTGTGAA

22,275,889

TGGTAGACGGGTAGATGTTG

22,276,079

RPPG8-007

8

53

(GGT)7

ACCACCACCTCTTCCAATC

86,262

ACCTCAAAGTGTCCCAGAAA

86,469

RPPG8-028

8

58

(AACCC)6

AAGGAGCCGACATCAGAAC

20,410,671

TGACCAGAAGCCAAATACATC

20,410,876

T A annealing temperature, Peach v1.0 start location in the peach genome sequence.

Table 5

Population statistics of 26 peach-derived long-core repeat SSR markers developed for five Prunus species

SSR ID

Pseudo chrom.

N. bases in repeat

N. locia

N. allelesb

Alleles range

N. amplified samplesc

Ho

He

PIC

NE-I

FIS

fnull

N. amplified species

Almond

 RPPG1-017

1

5

1

3

177–188

18

0.444

0.427

0.349

0.408

−0.040

0.0001

5

 RPPG1-026

1

3

1

2

239–242

18

0.111

0.108

0.099

0.807

−0.028

0.0038

4

 RPPG1-032

1

3

1

1

221

18

4

 RPPG1-037

1

3

1

3

230–242

18

0.833

0.684

0.591

0.186

−0.218

0.0011

4

 RPPG1-041

1

3

1

8

238–255

18

0.833

0.768

0.712

0.099

−0.085

0.0087

5

 RPPG2-011

2

4

>1

12

203–277

18

5

 RPPG2-022

2

4

>1

10

208–239

18

5

 RPPG3-026

3

4

>1

4

241–253

18

5

 RPPG4-059

4

5

1

2

132–161

18

0.056

0.056

0.053

0.896

0

0.0198

3

 RPPG4-067

4

5

1

4

261–275

18

0.611

0.662

0.596

0.174

0.077

0.0020

3

 RPPG4-077

4

4

1

4

131–151

18

0.611

0.703

0.617

0.167

0.131

0.0159

5

 RPPG4-084

4

4

1

5

271–297

18

0.556

0.638

0.545

0.219

0.129

0.0159

5

 RPPG4-091

4

5

1

3

245–249

18

0.056

0.500

0.424

0.327

0.888*

0.1512

5

 RPPG5-018

5

3

1

8

160–197

18

0.778

0.765

0.707

0.102

−0.017

0.0122

4

 RPPG5-022

5

3

>1

7

271–301

18

3

 RPPG5-023

5

3

1

2

192–193

18

0.667

0.489

0.362

0.388

−0.364

0.0111

4

 RPPG5-025

5

5

>1

5

301–316

18

4

 RPPG5-030

5

4

1

2

163–167

18

0.167

0.157

0.141

0.729

−0.064

0.0123

5

 RPPG6-009

6

5

1

3

181–191

18

0.333

0.494

0.388

0.362

0.326

0.0335

4

 RPPG6-032

6

5

>1

3

141–151

18

4

 RPPG6-033

6

4

>1

9

93–130

18

5

 RPPG7-015

7

4

>1

8

290–332

18

4

 RPPG7-026

7

5

1

2

152–161

18

0.444

0.457

0.346

0.407

0.028

0.0086

5

 RPPG7-032

7

3

1

4

186–201

18

0.611

0.575

0.488

0.265

−0.063

0.0025

5

 RPPG8-007

8

3

1

3

189–214

18

0.389

0.414

0.363

0.396

0.060

0.0045

5

 RPPG8-028

8

5

1

4

192–215

18

0.722

0.660

0.583

0.187

−0.094

0.0020

4

 Mean d

3.6

0.474

0.503

0.433

9.48 × 10 10

Apricot

 RPPG1-017

1

5

1

3

165–169

18

0.500

0.579

0.473

0.281

0.136

0.0080

5

 RPPG1-026

1

3

1

2

223–235

18

0.389

0.500

0.368

0.382

0.222

0.0151

4

 RPPG1-032

1

3

1

2

227–234

18

0.056

0.056

0.053

0.896

0

0.0131

4

 RPPG1-037

1

3

1

5

228–251

18

0.389

0.694

0.633

0.148

0.439*

0.0171

4

 RPPG1-041

1

3

1

3

212–214

18

0.056

0.652

0.558

0.21

0.914*

0.1480

5

 RPPG2-011

2

4

>1

4

194–218

18

5

 RPPG2-022

2

4

>1

7

215–241

18

5

 RPPG3-026

3

4

1

2

239–249

18

0.389

0.322

0.264

0.521

−0.208

0.0043

5

 RPPG4-059

4

5

1

1

132

18

3

 RPPG4-067

4

5

1

1

259

18

3

 RPPG4-077

4

4

1

4

136–151

18

0.222

0.257

0.237

0.575

0.136

0.0061

5

 RPPG4-084

4

4

1

2

276–285

18

0.333

0.413

0.321

0.439

0.194

0.0068

5

 RPPG4-091

4

5

1

2

217–228

18

0.111

0.108

0.099

0.807

−0.028

0.0128

5

 RPPG5-018

5

3

1

4

177–197

15

0.333

0.582

0.465

0.288

0.428

0.1536

4

 RPPG5-022

5

3

1

3

271–299

18

0.444

0.560

0.445

0.307

0.207

0.0112

3

 RPPG5-023

5

3

1

3

181–206

18

0.444

0.541

0.450

0.301

0.179

0.0101

4

 RPPG5-025

5

5

1

2

275–283

18

0.056

0.056

0.053

0.896

0

0.0292

4

 RPPG5-030

5

4

1

2

154–167

18

0.056

0.056

0.053

0.896

0

0.0210

5

 RPPG6-009

6

5

1

1

191

18

4

 RPPG6-032

6

5

1

2

151–157

18

0.278

0.246

0.211

0.607

−0.130

0.0048

4

 RPPG6-033

6

4

1

6

101–119

18

0.389

0.670

0.609

0.163

0.419*

0.0331

5

 RPPG7-015

7

4

1

4

304–322

17

0.471

0.606

0.513

0.245

0.223

0.0768

4

 RPPG7-026

7

5

1

2

161–170

18

0.111

0.108

0.099

0.807

−0.028

0.0129

5

 RPPG7-032

7

3

1

2

186–189

18

0.333

0.286

0.239

0.560

−0.164

0.0068

5

 RPPG8-007

8

3

1

2

184–193

18

0.111

0.108

0.099

0.807

−0.028

0.0172

5

 RPPG8-028

8

5

>1

8

192–215

17

4

 Mean d

2.9

0.274

0.370

0.312

6.00 × 10 8

Japanese plum

 RPPG1-017

1

5

1

5

172–184

18

0.833

0.659

0.593

0.177

−0.264

0.0033

5

 RPPG1-026

1

3

1

2

230–235

18

0.056

0.157

0.141

0.729

0.643

0.0401

4

 RPPG1-032

1

3

1

2

225–231

18

0.611

0.475

0.355

0.397

−0.286

0.0122

4

 RPPG1-037

1

3

1

2

234–237

18

0.167

0.157

0.141

0.729

−0.064

0.0117

4

 RPPG1-041

1

3

1

5

219–247

18

0.722

0.616

0.518

0.242

−0.172

0.0053

5

 RPPG2-011

2

4

>1

9

196–232

18

5

 RPPG2-022

2

4

>1

4

195–265

18

5

 RPPG3-026

3

4

1

8

255–355

18

0.889

0.878

0.836

0.039

−0.013

0.0091

5

 RPPG4-059

4

5

1

3

155–178

18

0.389

0.338

0.300

0.480

−0.151

0.0148

3

 RPPG4-067

4

5

1

2

265–270

18

0.167

0.157

0.141

0.729

−0.064

0.0184

3

 RPPG4-077

4

4

1

3

125–136

18

0.056

0.252

0.226

0.589

0.778*

0.0975

5

 RPPG4-084

4

4

1

3

285–330

18

0.278

0.675

0.582

0.192

0.588*

0.1501

5

 RPPG4-091

4

5

1

4

226–258

18

0.778

0.605

0.522

0.236

−0.286

0.0044

5

 RPPG5-018

5

3

1

7

160–197

15

0.467

0.717

0.643

0.144

0.349*

0.2096

4

 RPPG5-022

5

3

>1

6

252–299

18

3

 RPPG5-023

5

3

1

2

181–184

18

0.167

0.157

0.141

0.729

−0.064

0.0091

4

 RPPG5-025

5

5

1

3

277–285

18

0.667

0.589

0.479

0.277

−0.132

0.0060

4

 RPPG5-030

5

4

1

3

154–167

18

0.611

0.475

0.378

0.374

−0.286

0.0103

5

 RPPG6-009

6

5

1

2

186–191

18

0.500

0.386

0.305

0.461

−0.295

0.0094

4

 RPPG6-032

6

5

1

2

147–152

18

0.444

0.356

0.286

0.488

−0.247

0.0101

4

 RPPG6-033

6

4

>1

5

101–119

18

5

 RPPG7-015

7

4

>1

9

230–316

18

4

 RPPG7–026

7

5

1

4

143–161

18

0.556

0.713

0.638

0.149

0.220

0.0252

5

 RPPG7-032

7

3

1

2

186–189

18

0.167

0.246

0.211

0.607

0.321

0.0351

5

 RPPG8-007

8

3

1

2

180–194

18

0.056

0.056

0.053

0.896

0

0.0160

5

 RPPG8-028

8

5

>1

8

189–224

18

4

 Mean d

3.3

0.429

0.433

0.374

6.50 × 10 10

Peach

 RPPG1-017

1

5

1

4

205–227

18

0.389

0.490

0.437

0.314

0.206

0.0051

5

 RPPG1-026

1

3

1

1

239

18

4

 RPPG1-032

1

3

1

2

221–225

18

0.056

0.056

0.053

0.896

0

0.0050

4

 RPPG1-037

1

3

1

1

242

18

4

 RPPG1-041

1

3

1

2

223–231

18

0.333

0.457

0.346

0.407

0.271

0.0050

5

 RPPG2-011

2

4

1

2

203–226

18

0.500

0.386

0.305

0.461

−0.295

0.0014

5

 RPPG2-022

2

4

1

2

209–214

18

0.222

0.356

0.286

0.488

0.376

0.0069

5

 RPPG3-026

3

4

1

2

245–249

18

0.500

0.513

0.374

0.376

0.025

0.0008

5

 RPPG4-059

4

5

1

3

176–187

18

0.444

0.589

0.479

0.277

0.246

0.0055

3

 RPPG4-067

4

5

1

1

271

18

3

 RPPG4-077

4

4

1

2

151–160

18

0.333

0.514

0.375

0.375

0.352

0.0107

5

 RPPG4-084

4

4

1

2

279–281

18

0.389

0.513

0.374

0.376

0.242

0.0020

5

 RPPG4-091

4

5

1

2

239–245

18

0.444

0.508

0.372

0.378

0.126

0.0049

5

 RPPG5-018

5

3

1

2

177–190

18

0.444

0.489

0.362

0.388

0.092

0.0003

4

 RPPG5-022

5

3

1

1

301

18

3

 RPPG5-023

5

3

1

2

192–196

18

0.333

0.286

0.239

0.560

−0.164

0.0022

4

 RPPG5-025

5

5

1

1

301

18

4

 RPPG5-030

5

4

1

2

167–169

18

0.056

0.056

0.053

0.896

0.000

0.0044

5

 RPPG6-009

6

5

1

2

181–196

18

0.111

0.108

0.099

0.807

−0.028

0.0062

4

 RPPG6-032

6

5

1

1

151

18

4

 RPPG6-033

6

4

1

2

116–118

18

0.500

0.475

0.355

0.397

−0.053

0.0024

5

 RPPG7-015

7

4

1

4

275–303

18

0.611

0.537

0.463

0.287

−0.138

0.0025

4

 RPPG7-026

7

5

1

3

157–175

18

0.278

0.541

0.414

0.337

0.486*

0.0044

5

 RPPG7-032

7

3

1

2

193–196

18

0.111

0.108

0.099

0.807

−0.028

0.0014

5

 RPPG8-007

8

3

1

3

205–214

18

0.056

0.160

0.149

0.719

0.650

0.0082

5

 RPPG8-028

8

5

1

2

207–212

18

0.167

0.386

0.305

0.461

0.567

0.0029

4

 Mean d

2.4

0.314

0.376

0.297

2.30 × 10 7

Sweet cherry

 RPPG1-017

1

5

1

3

176–196

17

0.059

0.169

0.157

0.705

0.651

0.1703

5

 RPPG1-026

1

3

1

2

274–298

18

0.389

0.437

0.334

0.421

0.110

0.0117

4

 RPPG1-032

1

3

1

3

225–231

18

0.833

0.589

0.479

0.277

−0.414*

0.0058

4

 RPPG1-037

1

3

1

5

237–265

18

0.444

0.635

0.543

0.220

0.301

0.0209

4

 RPPG1-041

1

3

1

6

222–237

17

0.706

0.742

0.682

0.116

0.049

0.0172

5

 RPPG2-011

2

4

>1

4

185–224

18

5

 RPPG2-022

2

4

1

5

221–234

18

0.889

0.778

0.713

0.102

−0.143

0.0026

5

 RPPG3-026

3

4

1

2

239–249

18

0.111

0.108

0.099

0.807

−0.028

0.0183

5

 RPPG4-059

4

5

1

1

132

18

3

 RPPG4-067

4

5

1

2

260–265

18

0.056

0.056

0.053

0.896

0

0.0204

3

 RPPG4-077

4

4

1

3

141–148

18

0.444

0.514

0.449

0.301

0.136

0.0167

5

 RPPG4-084

4

4

1

2

287–290

17

0.529

0.515

0.375

0.375

−0.027

0.0312

5

 RPPG4-091

4

5

1

4

245–290

18

0.778

0.717

0.649

0.140

−0.085

0.0011

5

 RPPG5-018

5

3

1

1

179

18

4

 RPPG5-022

5

3

1

1

295

17

3

 RPPG5-023

5

3

1

0

0

4

 RPPG5-025

5

5

1

4

275–289

18

0.722

0.694

0.607

0.173

−0.040

0.0096

4

 RPPG5-030

5

4

1

3

163–167

18

0.389

0.522

0.404

0.346

0.255

0.0224

5

 RPPG6-009

6

5

1

2

197–207

18

0.556

0.413

0.321

0.439

−0.346

0.0067

4

 RPPG6-032

6

5

1

2

147–152

18

0.056

0.056

0.053

0.896

0

0.0125

4

 RPPG6-033

6

4

1

3

95–105

17

0.824

0.540

0.414

0.336

−0.526*

0.0123

5

 RPPG7-015

7

4

1

0

0

4

 RPPG7-026

7

5

1

2

175–178

18

0.167

0.157

0.141

0.729

−0.064

0.0052

5

 RPPG7-032

7

3

1

3

192–201

18

0.556

0.538

0.412

0.338

−0.033

0.0077

5

 RPPG8-007

8

3

1

3

196–208

18

0.389

0.332

0.285

0.496

−0.172

0.0061

5

 RPPG8-028

8

5

1

1

201

18

4

 Mean d

3.1

0.468

0.448

0.378

2.39 × 10 9

Ho observed heterozygosity, He expected heterozygosity, PIC polymorphic information content, NE-I Probability of Identity, F IS inbreeding coefficient, fnull frequencies of null alleles.

* value significantly different from zero at α < 0.05.

aMultilocus markers (N. loci >1) were not used to calculate population parameters.

bfor multilocus SSRs the number reported refers to the number of fragments.

cThere are no “missing data” in this matrix. If the number of amplified samples is <18 the sample amplification did not gave a product in at least two repetitions and was thus considered as a null allele (see the main text for details).

dMeans calculated exluding monomorfic and multilocus SSRs; For NE-I the combined probability of identity is reported.

Nine SSRs detected more than one locus in at least one species. However, even if patterns were more complex due to the higher number of peaks, all primer pairs resulted in a high quality scoring. All the markers confirmed to target single loci in peach, whereas a multi locus pattern was more frequent in the other diploid Prunus species: eight were found in almond, six in Japanese plum, three in apricot and one in sweet cherry. As reported by Verde et al. (2013) Prunus did not undergo recent whole genome duplication. However, a segmental duplication has been described in peach in MADS-box (Bielenberg et al. 2008) and in MYB transcription factors (Zhou et al. 2014). Duplicated SSR loci have also been often described in Prunus, as may be highlighted in the different linkage maps obtained in the last decades (Dirlewanger et al. 2004; Verde et al. 2005; Dondini et al. 2007). All the 26 primer pairs were polymorphic in Japanese plum, 25 in almond, 23 in apricot, 20 in cherry and 20 in peach, respectively.

The number of alleles per locus varied depending on the species, with the highest, equal to 8, found in almond and Japanese plum. The average number of alleles per species ranged from 2.4 (in peach) to 3.6 (in almond).The highest mean observed heterozygosity within the five species was found in almond (0.474) closely followed by sweet cherry (0.468) and Japanese plum (0.429); in peach and apricot it was 0.314 and 0.274, respectively. Heterozygosity values reported in literature for each of these species show wide range of variation depending on many factors such as the number and choice of accessions, the SSR set used and the electrophoretic system chosen for fragment separation. We obtain here values (Table 5) that are generally lower than those reported in literature. However all the previous works used shorter motif repeats (mostly di-nuclotides), which are known to be more variable than long core repeats (Chakraborty et al. 1997; Vigouroux et al. 2002).

Inbreeding coefficients (Table 5) generally displayed values slightly different from zero. Based on the permutation test, FIS values were found significantly different from zero at α < 0.05 in a few loci, distributed across all the five species: one single locus in peach and almond, two loci in cherry and three loci each in plum and apricot. Departures from Hardy–Weinberg equilibrium (HWE) had in all cases a positive sign, revealing an excess of homozygotes, with the exception of cherry, where both the markers (RPPG1-032 and RPPG6-033) displayed an excess of heterozygotes. The excess of homozygotes in a population departing from HWE could indicate the presence of null alleles, which is not easily verifiable without direct observation such as in segregation or parentage analyses. To account for the presence of null alleles avoiding biases due to inbreeding, estimation of null allele frequency was performed under the model with the lowest DIC value, as estimated with the INEST software. The nbf model, simultaneously accounting for inbreeding and null alleles, was found to better fit data for all the species with the exception of Japanese plum.

The frequencies of null alleles (fnull) are listed in Table 5. Among loci displaying a significant excess in homozygotes, the lowest value was found, as expected, in peach (0.004) and the highest in Japanese plum with marker RPPG5-018 (0.210). This marker displayed three unamplified samples both in Japanese plum and apricot, thus supporting the presence of a null allele, already hypothesized after repeating the amplifications. In apricot, two (‘Bergeron’ and ‘Comedie’) of the three cultivars independently scored as homozygous for a null allele are known to have a parent-offspring relationship (Table 1). In a few cases the IIM estimate of null allele presence is consistent with homozygote–homozygote mismatches in known parent-offspring relationships. For some accessions parental relationships were available from literature (Table 1): in apricot, the cv Ninfa is known to be an offspring of ‘Tyrinthos’ (Table 1). The genotyping results with our set of markers are all compatible with this pedigree with the exception of the RPPG1-041 marker. For this locus, showing a homozygous pattern with the Tyrinthos 213 allele, admitting the presence of a null allele could meet the genealogy of the cultivar. The same happens with marker RPPG4-091 in almond for cv Tuono (parent) and Moncayo (offspring).

The known parental relationships (Table 1) were also used to assess the effectiveness of the marker set for parentage analyses. In sweet cherry pedigree information could be fully confirmed for one cultivar, being both parents present in our genotyped materials, and for three further varieties it was compatible with the genetic profile of the single parent present in our panel. The parental relationship of ‘Van’ as offspring of ‘Rainier’ was found inconsistent in two different loci (RPPG5-030 and RPPG4-091). In almond, six cultivars could be assessed (Table 1) but only two pedigrees could be confirmed: ‘Ferragnes’ and ‘Ferraduel’, sharing ‘Cristomorto’ as parent. The four unmatching results could be explained by mislabeling in one of the many steps involved in the collection setup, and further analysis should be performed to confirm or discard the pedigrees.

The highest PIC index was found in plum (0.836), while the highest average value was found in almond (0.433). The locus RPPG1-041 was the most informative, with the highest average PIC value in the five Prunus species (0.563), and the locus RPPG6-032 was the least informative (average PIC = 0.183). The efficiency of the peach-derived long-core repeat markers was different in the five species tested. Fourteen primer pairs showed a PIC value higher than 0.300 in almond, a threshold under which markers are considered scarcely polymorphic (Botstein et al. 1980). Likewise, 11 primer pairs showed a PIC value higher than 0.300 in Japanese plum, 13 in sweet cherry, 13 in peach and 10 in apricot (Table 5). Further multilocus highly variable primer pairs were found that could be useful in fingerprinting and paternity tests: eight in almond (3–12 different fragments), six in plum (4–9 fragments), one in cherry. The combined probability of identity (combined NE-I) between two random individuals for the whole set of 26 SSRs was quite low ranging from 2.30 × 10−7 in peach to 9.48 × 10−10 in almond, confirming the usefulness of the proposed set for fingerprinting analyses in Prunus species.

All the eighteen cultivars of each of the five Prunus species could be genetically identified with the set of long-core repeat SSR markers (Figure 1). Relationships among the species shown in the dendrogram were in agreement with the classification proposed by Bortiri et al. (2006) with peach and almond closely linked and belonging to the Amygdalus subgenus, Prunus armeniaca and Prunus salicina more distant and belonging to the Prunus sensu lato; all the four species belonging to a single clade. Prunus avium, belonging to a different clade is classified as Cerasus subgenus. Genetic distances displayed in the tree were obtained by using the full dataset, including multilocus markers, while population stratification results were obtained by using only single locus markers. Both these datasets gave a similar representation of the relationships inside each species.
Figure 1

Tree obtained from the analysis of 90 accessions belonging to five Prunus species. The tree was constructed with the UPGMA method using the complete tri-, tetra-, and penta-nucleotide data set.

The developed set of markers was able to reveal population structure in all the five species analyzed; an accession was declared as part of a subpopulation when its membership coefficient was higher than 0.8. In peach, two subpopulations (K = 2) were estimated, which can be ascribed to the eastern (P1, five accessions) and western (P2, nine accessions) germplasm as already observed by Micheletti et al. (2012) and Li et al. (2013). The oriental group included four known oriental accessions (‘Sahua Hong Pantao’, ‘Yumyeong’, ‘Ferganensis’, ‘Shenzhou Mitao’) and ‘Babygold 8’; the latter is a western cultivar obtained in the USA but in accordance to our results, it is reported to have not less than 75% of Chinese blood (Okie 1998). The nine accessions included in P2 are all of well-known western origin, with the exception of Quetta, an old nectarine cultivar collected in 1906 in India, already reported to cluster with western germplasm by Verde et al. (2013, supplementary information). The obtained peach population structure is represented in Figure 2. In the above mentioned works (Micheletti et al. 2012; Li et al. 2013), carried out with a larger number of plant materials and markers, the best population stratification estimate was at K = 3 as the western subpopulation resulted further divided into modern and traditional accessions. In cherry, three subpopulations were observed comprising 15 accessions. One of the subpopulations had three samples in common with the modern cultivars subpopulation identified by Mariette et al. (2010). Two further shared cultivars, belonging to the landrace group in the results of Mariette et al. (2010), were admixed in our work. In apricot, two subpopulations of five and six cultivars, respectively, were observed, while seven accessions were admixed. Five accessions were in common with the larger work of Bourguiba et al. (2012), one of them defining the “Adaptive Diversity” group, and three the “North Mediterranean basin” one. The fifth accession, which in their results belonged to the North Mediterranenan basin, remained admixed in our work.
Figure 2

Population stratification of 18 peach accessions. Above the figure it is reported the location where the accessions were collected or developed and, in brackets, the two subgroups (K = 2) to which they were assigned by STRUCTURE. Adm admixed, P1 subgroup 1 (light grey), P2 subgroup 2 (dark grey).

Due to the lack of information, comparison with previous results was not possible in Japanese plum (K = 2). In the case of almond we could not identify a stable value of stratification. Delplancke et al. (2013) in their extensive work carried out an analysis of over 1,000 accessions, identified six clusters, but we could not make any comparison for the unavailability of common material.

Some unexpected variants, insertions or deletions, have to be inferred due to allele size differences from what could be expected from the core repeat profiles. We found both, one and two bases variants, confirmed by a second DNA extraction and analysis of all the samples where such differences were found, thus excluding PCR or electrophoresis artifacts. The tetra-nucleotide microsatellites were found more prone to include variants of two bases. This kind of variation was recorded in at least one species, in all our tetra-nucleotide SSRs with the only exception of the primer pair RPPG4-077 where the assigned allele length variations were consistent with the repetitive motif length. A similar behavior was reported in olive where some hexa-nucleotide microsatellites showed 3–5 bp differences (De la Rosa et al. 2013). The presence of variations that deviate from the core repeat multiples could be caused by complex mutation patterns as reported for Coffea (Poncet et al. 2006).

The main difference between di-nucleotide and long-core repeat microsatellite markers consist of the higher number of alleles usually displayed by the first ones, with a frequent 2 bp allelic incremental step, which results in peaks of true alleles overlapping stuttering peaks of the closest alleles (Cipriani et al. 2008). Microsatellites with longer core motifs have a lower number of alleles, larger peak distances, and stuttering peaks are attenuated, which all contribute to a more reliable scoring of microsatellites. An example of the difference among di-nucleotides and three, four- and five-nucleotides is reported in Figure 3.
Figure 3

Examples of di- tri- four and penta-nucleotide SSR profiles. In red the DNA size Standard 400. a Profile of three di-nucleotide SSRs often used in Prunus analyses, each labeled with a different fluorochrome. b Profile of newly developed tri- tetra- and penta-nucleotide SSRs, each labeled with a different fluorochrome.

Conclusions

Access to the whole genome sequence of plants offers the opportunity to develop molecular markers tailored to different needs and purposes. Though less abundant than single nucleotide polymorphic markers (SNP), microsatellites are more efficient in low- to medium-throughput analyses where their multi-allelic nature outperforms the bi-allelic power of discrimination of SNPs. Long-core repeat microsatellites represent an advancement in the exploitation of SSR markers in fingerprinting analyses as they enable to overcome some ambiguities due to technical intrinsic issues, such as stuttering and difficulties in binning and sizing of alleles.

In this work the availability of the peach genome sequence enabled the recovery of thousands of perfect microsatellite markers with long-core repeats, namely penta-, tetra- and tri-nucleotides. A set of 26 long-core repeat markers was developed to be used in five Prunus species of preeminent economic importance and its effectiveness for many different purposes such as individual identification, parentage and population structure analysis was assessed. Further 190 markers were developed and tested for polymorphism in the five species and, even if they were not included in the Prunus set, they could still be useful for several genetic analyses.

The use of the set developed in the present work is particularly suited for all those applications where comparisons are to be made among results from different laboratories, different protocols or instruments and where molecular data have to be assigned as a reference, as is the case of database establishment or in germplasm collection management and maintenance. The straightforward scorability of these long-core SSR patterns should also simplify the task of developing multiplex PCR systems in Prunus, greatly improving the efficiency of genotyping. We propose to add the long-core repeat microsatellites presented here in the protocols of the future studies of individual identification of the five species of Prunus considered in this work.

Declarations

Authors’ contributions

MTD, IV and GC conceived and designed the study. SS mined the SSRs from the Peach Genome. JG designed the SSR primers and obtained the SSR data, MTD and SM performed the statistical analysis, MTD, SM, IV, GD wrote and revised the paper. All authors read and approved the final manuscript.

Acknowledgements

Work funded by the Italian Ministry of Agriculture (MiPAAF)—DM 2430 Progetto RGV-FAO. We thank Dr. Andrea Carta for developing the pipeline for locating SSRs within the protein-coding genes.

Compliance with ethical guidelines

Competing interests The authors declare that they have no competing interests. Dr. Simone Scalabrin, one of the authors of the manuscript, is currently affiliated with IGA Technology Services. This does not alter the authors’ adherence to all Springer Plus policies on sharing data and materials.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Consiglio per la Ricerca in Agricoltura e l’analisi dell’economia agraria, Centro di Ricerca per la Frutticoltura
(2)
IGA Technology Services
(3)
Dipartimento di Scienze Agrarie e Ambientali, University of Udine

References

  1. Abajian C (1994) Sputnik espresso software development. In: Softw. Modif. Cornell Univ. http://wheat.pw.usda.gov/ITMI/EST-SSR/LaRota. Accessed 21 Apr 2015
  2. Aranzana MJ, Abbassi E-K, Howad W, Arús P (2010) Genetic variation, population structure and linkage disequilibrium in peach commercial varieties. BMC Genet 11:69View ArticleGoogle Scholar
  3. Bielenberg DG, Wang YE, Li Z, Zhebentyayeva T, Fan S, Reighard GL et al (2008) Sequencing and annotation of the evergrowing locus in peach [Prunus persica (L.) Batsch] reveals a cluster of six MADS-box transcription factors as candidate genes for regulation of terminal bud formation. Tree Genet Genomes 4:495–507View ArticleGoogle Scholar
  4. Bortiri E, Heuvel BV, Potter D (2006) Phylogenetic analysis of morphology in Prunus reveals extensive homoplasy. Plant Syst Evol 259:53–71View ArticleGoogle Scholar
  5. Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32:314Google Scholar
  6. Bourguiba H, Audergon J-M, Krichen L, Trifi-Farah N, Mamouni A, Trabelsi S et al (2012) Loss of genetic diversity as a signature of apricot domestication and diffusion into the Mediterranean Basin. BMC Plant Biol 12:49View ArticleGoogle Scholar
  7. Butler JM (2006) Genetics and genomics of core short tandem repeat loci used in human identity testing. J Forensic Sci 51:253–265View ArticleGoogle Scholar
  8. Butler JM, Buel E, Crivellente F, McCord BR (2004) Forensic DNA typing by capillary electrophoresis using the ABI Prism 310 and 3100 genetic analyzers for STR analysis. Electrophoresis 25:1397–1412View ArticleGoogle Scholar
  9. Byrne DH (1990) Isozyme variability in four diploid stone fruits compared with other woody perennial plants. J Hered 81:68–71Google Scholar
  10. Chakraborty R, Kimmel M, Stivers DN, Davison LJ, Deka R (1997) Relative mutation rates at di-, tri-, and tetranucleotide microsatellite loci. Proc Natl Acad Sci 94:1041–1046View ArticleGoogle Scholar
  11. Chybicki IJ, Burczyk J (2009) Simultaneous estimation of null alleles and inbreeding coefficients. J Hered 100:106–113View ArticleGoogle Scholar
  12. Cipriani G, Lot G, Huang W-G, Marrazzo MT, Peterlunger E, Testolin R (1999) AC/GT and AG/CT microsatellite repeats in peach [Prunus persica (L) Batsch]: isolation, characterisation and cross-species amplification in Prunus. Theor Appl Genet 99:65–72View ArticleGoogle Scholar
  13. Cipriani G, Marrazzo MT, Di Gaspero G, Pfeiffer A, Morgante M, Testolin R (2008) A set of microsatellite markers with long core repeat optimized for grape (Vitis spp.) genotyping. BMC Plant Biol 8:127View ArticleGoogle Scholar
  14. Cipriani G, Spadotto A, Jurman I, Di Gaspero G, Crespan M, Meneghetti S et al (2010) The SSR-based molecular profile of 1005 grapevine (Vitis vinifera L.) accessions uncovers new synonymy and parentages, and reveals a large admixture amongst varieties of different geographic origin. Theor Appl Genet 121:1569–1585View ArticleGoogle Scholar
  15. De la Rosa R, Belaj A, Muñoz-Mérida A, Trelles O, Ortíz-Martín I, González-Plaza JJ et al (2013) Development of EST-derived SSR markers with long-core repeat in olive and their use for paternity testing. J Am Soc Hortic Sci 138:290–296Google Scholar
  16. Decroocq V, Favé MG, Hagen L, Bordenave L, Decroocq S (2003) Development and transferability of apricot and grape EST microsatellite markers across taxa. Theor Appl Genet 106:912–922Google Scholar
  17. Delplancke M, Alvarez N, Benoit L, Espíndola A, I Joly H, Neuenschwander S et al (2013) Evolutionary history of almond tree domestication in the Mediterranean basin. Mol Ecol 22:1092–1104View ArticleGoogle Scholar
  18. Dettori MT, Quarta R, Verde I (2001) A peach linkage map integrating RFLPs, SSRs, RAPDs, and morphological markers. Genome 44:783–790View ArticleGoogle Scholar
  19. Dirlewanger E, Cosson P, Tavaud M, Aranzana M, Poizat C, Zanetto A et al (2002) Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theor Appl Genet 105:127–138View ArticleGoogle Scholar
  20. Dirlewanger E, Graziano E, Joobeur T, Garriga-Calderé F, Cosson P, Howad W et al (2004) Comparative mapping and marker-assisted selection in Rosaceae fruit crops. Proc Natl Acad Sci USA 101:9891–9896. doi:https://doi.org/10.1073/pnas.0307937101 View ArticleGoogle Scholar
  21. Dondini L, Lain O, Geuna F, Banfi R, Gaiotti F, Tartarini S et al (2007) Development of a new SSR-based linkage map in apricot and analysis of synteny with existing Prunus maps. Tree Genet Genomes 3:239–249View ArticleGoogle Scholar
  22. Earl DA, vonHoldt BM (2012) STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour 4:359–361View ArticleGoogle Scholar
  23. Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol 14:2611–2620. doi:https://doi.org/10.1111/j.1365-294X.2005.02553.x View ArticleGoogle Scholar
  24. Faria DA, Mamani EMC, Pappas GJ Jr, Grattapaglia D (2011) Genotyping systems for Eucalyptus based on tetra-, penta-, and hexanucleotide repeat EST microsatellites and their use for individual fingerprinting and assignment tests. Tree Genet Genomes 7:63–77View ArticleGoogle Scholar
  25. Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J et al (2012) Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res 40:D1178–D1186View ArticleGoogle Scholar
  26. Gunderson KL (2009) Whole-genome genotyping on bead arrays. Methods Mol Biol 529:197–213View ArticleGoogle Scholar
  27. Hammond HA, Jin L, Zhong Y, Caskey CT, Chakraborty R (1994) Evaluation of 13 short tandem repeat loci for use in personal identification applications. Am J Hum Genet 55:175Google Scholar
  28. Hegedüs A, Szabó Z, Nyéki J, Halász J, Pedryc A (2006) Molecular analysis of S-haplotypes in peach, a self-compatible Prunus species. J Am Soc Hortic Sci 131:738–743Google Scholar
  29. Hellmann AP, Rohleder U, Eichmann C, Pfeiffer I, Parson W, Schleenbecker U (2006) A proposal for standardization in forensic canine DNA typing: allele nomenclature of six canine-specific STR loci. J Forensic Sci 51:274–281View ArticleGoogle Scholar
  30. Jakobsson M, Rosenberg NA (2007) CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 23:1801–1806View ArticleGoogle Scholar
  31. Jung S, Jiwan D, Cho I, Lee T, Abbott A, Sosinski B et al (2009) Synteny of Prunus and other model plant species. BMC Genomics 10:76View ArticleGoogle Scholar
  32. Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol 16:1099–1106. doi:https://doi.org/10.1111/j.1365-294X.2007.03089.x View ArticleGoogle Scholar
  33. Leclercq S, Rivals E, Jarne P (2007) Detecting microsatellites within genomes: significant variation among algorithms. BMC Bioinform 8:125View ArticleGoogle Scholar
  34. Li X, Meng X, Jia H, Yu M, Ma R, Wang L et al (2013) Peach genetic resources: diversity, population structure and linkage disequilibrium. BMC Genet 14:84View ArticleGoogle Scholar
  35. Mariette S, Tavaud M, Arunyawat U, Capdeville G, Millan M, Salin F (2010) Population structure and genetic bottleneck in sweet cherry estimated with SSRs and the gametophytic self-incompatibility locus. BMC Genet 11:77View ArticleGoogle Scholar
  36. Micheletti D, Aramini V, Arús P, Banchi E, Barreneche T, Bassi D et al (2012) Genetic variability description in a wide germplasm of domesticated peach through high throughput genotyping. Book of Abstract 6th Rosaceous Genomics Conference Mezzocorona, ItalyGoogle Scholar
  37. Miller PJ, Parfitt DE, Weinbaum SA (1989) Outcrossing in peach. HortScience 24:359–360Google Scholar
  38. Mnejja M, Garcia-Mas J, Audergon J-M, Arús P (2010) Prunus microsatellite marker transferability across rosaceous crops. Tree Genet Genomes 6:689–700View ArticleGoogle Scholar
  39. Okie WR (1998) Handbook of peach and nectarine varieties: performance in the southeastern United States and index of names. U.S. Dept. of Agriculture, Agricultural Research Service ; National Technical Information Service, distributor, Springfield, VA, Washington, DCGoogle Scholar
  40. Peace C, Bassil N, Main D, Ficklin S, Rosyara UR, Stegmeir T et al (2012) Development and evaluation of a genome-wide 6K SNP array for diploid sweet cherry and tetraploid sour cherry. PLoS One 7:e48305View ArticleGoogle Scholar
  41. Perrier X, Jacquemoud-Collet JP (2006) DARwin software. Genetic improvement of vegetatively propagated crops. http://darwin.cirad.fr/darwin. Accessed 21 Apr 2015
  42. Poncet V, Rondeau M, Tranchant C, Cayrel A, Hamon S, de Kochko A et al (2006) SSR mining in coffee tree EST databases: potential use of EST–SSRs as markers for the Coffea genus. Mol Genet Genomics 276:436–449View ArticleGoogle Scholar
  43. Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945–959Google Scholar
  44. Rosenberg NA (2004) DISTRUCT: a program for the graphical display of population structure. Mol Ecol Notes 4:137–138View ArticleGoogle Scholar
  45. Ruitberg CM, Reeder DJ, Butler JM (2001) STRBase: a short tandem repeat DNA database for the human identity testing community. Nucleic Acids Res 29:320–322View ArticleGoogle Scholar
  46. Schlötterer C (2004) The evolution of molecular markers—just a matter of fashion? Nat Rev Genet 5:63–69View ArticleGoogle Scholar
  47. Scorza R, Mehlenbacher SA, Lightner GW (1985) Inbreeding and coancestry of freestone peach cultivars of the eastern United States and implications for peach germplasm improvement. J Am Soc Hortic Sci 110:547–552Google Scholar
  48. Shi J, Dai X, Chen Y, Chen J, Shi J, Yin T (2013) Discovery and experimental analysis of microsatellites in an oil woody plant Camellia chekiangoleosa. Plant Syst Evol 299:1387–1393View ArticleGoogle Scholar
  49. Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, McCouch S (2001) Computational and experimental analysis of microsatellites in Rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential. Genome Res 11:1441–1452. doi:https://doi.org/10.1101/gr.184001 View ArticleGoogle Scholar
  50. Vendramin E, Dettori MT, Giovinazzi J, Micali S, Quarta R, Verde I (2007) A set of EST-SSRs isolated from peach fruit transcriptome and their transportability across Prunus species. Mol Ecol Notes 7:307–310View ArticleGoogle Scholar
  51. Verde I, Lauria M, Dettori MT, Vendramin E, Balconi C, Micali S et al (2005) Microsatellite and AFLP markers in the Prunus persica [L. (Batsch)] × P. ferganensis BC1 linkage map: saturation and coverage improvement. Theor Appl Genet 111:1013–1021View ArticleGoogle Scholar
  52. Verde I, Bassil N, Scalabrin S, Gilmore B, Lawley CT, Gasic K et al (2012) Development and evaluation of a 9K SNP array for peach by internationally coordinated SNP detection and validation in breeding germplasm. PLoS One 7:e35668View ArticleGoogle Scholar
  53. Verde I, Abbott AG, Scalabrin S, Jung S, Shu S, Marroni F et al (2013) The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. Nat Genet 45:487–494View ArticleGoogle Scholar
  54. Vigouroux Y, Jaqueth JS, Matsuoka Y, Smith OS, Beavis WD, Smith JSC et al (2002) Rate and pattern of mutation at microsatellite loci in maize. Mol Biol Evol 19:1251–1260View ArticleGoogle Scholar
  55. Zhou Y, Zhou H, Lin-Wang K, Vimolmangkang S, Espley RV, Wang L et al (2014) Transcriptome analysis and transient transformation suggest an ancient duplicated MYB transcription factor as a candidate gene for leaf red coloration in peach. BMC Plant Biol 14:388View ArticleGoogle Scholar

Copyright

© Dettori et al. 2015