Skip to main content

Development of a PCR based marker system for easy identification and classification of aerobic endospore forming bacilli

Abstract

Restriction fragment length analysis of 16S rRNA gene of 52 different aerobic endospore forming Bacilli (AEFB) strains with HaeIII enzyme has revealed the presence of a 460 bp long fragment in 50 AEFB strains. BLAST analysis revealed that the fragment was 463 bp long and it was located at 3’ end of 16S rRNA gene. Further specificity of this fragment for AEFB strains was checked by PCR and in silico methods. In PCR based method a primer pair (463 F and 463R) specific to this fragment was designed and this primer pair has shown amplification of 463 bp fragment in AEFB strains only. In in silico methods homology of primer pair and presence of restriction enzyme site in 16S rRNA genes were checked in 268 species of AEFB. Almost all species of AEFB have shown positive results for both of the tests. Further multiple alignments of 463 bp sequences of different species of AEFB have shown that it is a good marker for identification and classification of AEFB.

Introduction

Aerobic endospore-formers have long been considered to be important components of the soil bacterial community (Mandic-Mulec and Prosser 2011). There is a great diversity of physiology among the aerobic spore formers. Their collective features include degradation of all substrates derived from plant and animal sources including cellulose, starch, pectin, proteins, agar, hydrocarbons and others, antibiotic production, nitrification, denitrification, nitrogen fixation, facultative lithotrophy, autotrophy, acidophily, alakliphily, psychrophily, thermophily and parasitism. Endospore formation, universally found in this group, is thought to be a strategy for survival even under adverse soil environment, where these bacteria predominate (Kumar et al. 2012). To get the beneficial effects of these AEFB it becomes very necessary to know how much diverse and abundant these microbes are in different soil ecosystems. Since 1990s various approaches based on phenotypic and genotypic characteristics have been applied to identify and classify the members of class Bacilli. Few decades before genus Bacillus was the only representative of class Bacilli among aerobic spore formers. Development of cultivation independent approaches have attracted microbiologist towards the molecular approaches for examining the microbes in a better way. Among different molecular methods, 16S rRNA gene sequencing is the best one. Since 1991, several new genera of aerobic spore formres like Amphibacillus (Niimura et al. 1990), Paenibacillus (Ash et al. 1991, 1993), Alicyclobacillus (Wisotzkey et al. 1992), Aneurinibacillus (Shida et al. 1996), Brevibacillus (Shida et al. 1996), Gracilibacillus (Waino et al. 1999), Salibacillus (Waino et al. 1999), Virgibacillus (Heyndrickx et al. 1998), Filobacillus (Schlesner et al. 2001), Geobacillus (Nazina et al. 2001), Jeotgalibacillus and Marinibacillus (Yoon et al. 2001) and Ureibacillus (Fortina et al. 2001) have been created based on this method. For phylogenetic arrangement of these newly discovered texa various markers based on 16S rDNA have been developed by different scientists (Priest et al. 1988; Ash et al. 1991; Gurtler and Stanisich 1996; Daffonchio et al. 1998a, b; Goto et al. 2000; Stackebrandt and Swiderski 2002; Xu and Cote 2003; De Clerck et al. 2004; Vardhan et al. 2011). Primer set developed by Garbeva et al. (2003) was found to be 100% specific for many of species of Bacillus and related genera. After a gap of years, Vardhan et al. (2011) developed a set of primers for identification of hyper variable region of 16S rDNA in different Bacillus species and partial sequencing of this hyper variable region behaves as an index for easy identification of species related to genera Bacillus.

With development of more advanced approaches to find cultivable and noncultivable diversity of microbes, lot of new species and genera, belonging to AEFB are discovering day by day. So, need of new marker systems is always there for proper identification and classification of these lineages. Hence the main objective of present study was to develop a simple and easy identification and classification tool for Bacillus and related genera which is an extension of research related to bacilli. The restriction digestion of amplified 16S rRNA gene by HaeIII enzyme has given a fragment of around 460 bp length in all species of Bacillus and related genera. Sequence information of this fragment (downloaded from NCBI) was used to find exact length of the fragment (463 bp) and to develop specific primers for amplification of this fragment in AEFB genera. Further sequence information and multiple alignment of 463 bp long sequences of different species of AEFB genera has revealed that this is an easy tool for identification and classification of the members of Bacillus and related genera. Another beneficial information provided by our study is that almost all species of Bacillus and related genera have restriction enzyme sites for Hae III enzyme which give a product of 460 bp. Restriction enzyme site for HaeIII are present at different positions in other bacterial lineages, therefore give product of different size after restriction digestion which clearly discriminate the Bacillus and related genera from others.

Material and methods

Bacterial strains

All of the bacterial strains used in the present study are Bacilli isolated from the rhizospheric soil of Phyllanthus amarus which were identified by 16S rRNA gene sequencing in our previous research work (Kadyan et al. 2013). Taxonomic information and accession numbers of isolates have been given in Table 1.

Table 1 Strain names and NCBI accession numbers of 52 AEFB strains isolated from rhizospheric soil of Phyllanthus amarus

16S rRNA gene amplification and restriction digestion by HaeIII enzyme

Gene coding for 16S rRNA gene of all of the 52 AEFB strains along with 10 reference strains (Shigella Flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumonia ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marcescens MTCC4822, Bacillus subtilis MTCC7193, and Staphylococcus aureus MTCC7443) was amplified by using universal primers i.e. B27f (5'-AGAGTTTGATCCTGGCTCAG-3') and U1492R (5'- GGTTACCTTGTTACGACTT-3') in thermal cycler (Biorad). Further reaction mixture for restriction digestion was prepared by mixing 8.5 μl of purified PCR products, 5 U of restriction endonuclease, HaeIII (Fermentas) and 1.0 μl of 10X recommendation buffer. Reaction mixture was incubated overnight in water bath at 37°C. Restriction digested DNA was analysed by horizontal electrophoresis in 2% agarose gels with 100 bp DNA marker. The gels were visualized on a gel documentation system (Alpha Innotech). Photograph of gel has been shown in Figure 1(a&b).

Figure 1
figure 1

Gel photograph showing ARDRA pattern of 52 AEFB strains (a) Gel photograph of ARDRA pattern of 52 AEFB strains digested with Hae III restriction enzyme.(b) Gel photograph of ARDRA pattern of 10 reference strains digested with Hae III restriction enzyme. (c) Gel photograph of PCR amplified 463 bp fragments in 52 strains of AEFB. (d) Gel photograph of PCR amplification result of 463 bp fragments in 10 reference strains. (a) Lane M - 100 bp DNA marker. Lanes 1–52 indicate bacterial strain codes (2.P1, 3.P1, 4.P1, 6.P1, 7.P1, 8.P1, 11.P1, 13.P1, 15.P1, 16.P1, 19.P1, 20.P1, 23.P1, 24.P1, 27.P1, 30.P1, M, 2.P2, 3.P2, 7.P2, 8.P2, 15.P2, 16.P2, 19.P2, 20.P2, 23.P2, 14.P2, M, 1.P3, 3.P3, 5.P3, 6.P3, 7.P3, 8.P3, 9.P3, 10.P3, 11.P3, 12.P3, 13.P3, 14.P3, 17.P3, 18.P3, 24.P3, M, 23.P3, 25.p2, 26.P3, 27.P3, 31.P3, 36.P3, 37.P3, 38.P3, 41.P3, 43.p3, 44.p3). (b) Lane M -100 bp DNA marker, lane 1–10 Shigella flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumoniae ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marrcescens MTCC4822, Bacillus subtilis MTCC7193, Staphylococcus aureus MTCC7443. Arrow indicates the size of 460 bp fragment in Bacillus subtilis MTCC7193. (c): M - 100 bp DNA marker, lane 1–52 (1.P3, 2.P1, 2.P2, 3.P1, 3.P2, 3.P3, 4.P1, 5.P3, 6.P1, 6.P3, 7.P1, 7.P2, 7.P3, 8.P1, 8.P2, 8.P3, 9.P3, 10.P3, 11.P1, 11.P3, 12.P3, 13.P1, 13.P3, 14.P2, 14.P3, 15.P1, 15.P2, 16.P1, 16.P2, 17.P3, 18.P3, 19.P1, 19.P2, 20.P1, 20.P2, 23.P1, 23.P2, 23.P3, 24.P1, 24.P3, 25.P2, 26.P3, 27.P1, 27.P3, 30.P1, 31.P3, 36.P3, 37.P3, 38.P3, 41.P3, 43.P3, 44.P3). Arrow indicates the size of fragment. (d): Bacterial strain Bacillus subtilis MTCC7193, present in lane no. 3 has shown amplification of 463bp fragment and other reference strains have not shown any amplification. Arrow indicates the size of fragment compared with marker of 100 bp present in lane M.

Restriction pattern analysis and designing of oligonucleotide primers

Restriction pattern analysis of HaeIII digested 16S rRNA gene has shown the presence of a fragment having length around 460 bp (Figure 1a) in all of the bacterial species belonging to Bacillus and related genera (except Bacillus arsenicus, Paenibacillus taiwanensis and 9 reference strains related to other bacterial lineages) (Figure 1b). On the basis of these observations it was assumed that this 460 bp fragment was specific for Bacillus and related genera. To find out the exact location and sequence information of this fragment, 16S rRNA gene sequence of all of the Bacillus isolates taken in our study was downloaded from NCBI gene bank database. All of the 16S rRNA gene sequences were checked for HaeIII enzyme cut sites (GG↓CC). Sequence between two cut sites having length of around 460 bp was found in all of the 16S rRNA gene sequences at same position. Further length of this region was found to be 461-463 bp. Primer pair specific to this region was designed by using software, Primer 3.0 and further synthesized from the facility available at Eurofins Genomics India Pvt. Ltd., Bangalore.

Sequence specificity of primer pair and occurrence of restriction enzyme site

The specificity of oligonucleotide primers was checked by PCR amplification of the 463 bp fragment in all of the 52 AEFB isolates along with 10 reference strains (Shigella Flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumonia ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marcescens MTCC4822, Bacillus subtilis MTCC7193, and Staphylococcus aureus MTCC7443). Reaction conditions for PCR were, initial denaturation at 94°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 20 seconds, extension at 72°C for 30 seconds and at last final extension at 72°C for 7 minutes. Theoretically primer pair was checked for its specificity in 16S rRNA gene sequences (downloaded from NCBI) in different species of Bacillus and related genera i.e. 153 different species of Bacillus, 20 Virgibacillus, 15 Geobacillus, 1 Filobacillus, 4 Jeotgalibacillus, 5 Ureibacillus, 21 Alicyclobacillus, 5 Amphibacillus, 5 Aneurinibacillus, 16 Brevibacillus, 9 Gracilibacillus, 5 Paenibacillus, 5 Lysinibacillus and 4 Terribacillus. A number of other bacterial lineages of Gram positive and negative bacteria were also checked for primer specificity which includes genera from phylum Firmicutes (other than Bacilli), Actinobacteria, Alpha Proteobacteria, Beta Proteobacteria and Gamma Proteobacteria.

Multiple alignment of 463 bp long partial 16S rDNA sequence of different species of Bacilli

To check the ability of marker for classification of Bacilli, we have done the multiple alignments of specific, 463 bp long sequences of 16S rRNA gene of 52 strains (taken in our study) with the reference sequences downloaded from NCBI. Multiple alignment of very closely related species of genus Bacillus (29 different species of Bacillus) lying in two nearby clusters in all species living tree by Yarza et al. (2010) has also been done to check the differentiation ability of this sequence. Software Clustal X 2.0 (Larkin et al. 2007) was used for alignment of different sequences and further alignment file was used in molecular evolutionary genetic analysis software version 5.1 (MEGA 5.1) (Tamura et al. 2011) for construction of phylogenetic tree.

Results

Oligonucleotide primers

Bacillus and related genera specific primers designed in our study were named as 463 F (5’CTAAAACTCAAAGGAATTGACG3’) and 463R (5’AATACGTTCCCGGGCCTT3’).

PCR amplification of 463 bp sequence

PCR amplification has confirmed the specificity of the primer pair in 52 AEFB strains and 10 reference strains. Out of total, 50 strains belonging to Bacillus and related genera have shown the amplification of the specific region. However, the region was not amplified in Bacillus arsenicus, Paenibacillus taiwanensis and 9 reference strains (Figure 1c & d).

Sequence homology of primers in 16S rRNA gene sequences of Bacillus and related genera

Primer sequences were found to be 100% similar with the 16S rRNA gene sequences (downloaded from NCBI) of 120 species of genera Bacillus, 13 Geobacillus, 1 Filobacillus, 4 Jeotgalibacillus, 5 Ureibacillus, 7 Alicyclobacillus, 2 Brevibacillus and 5 Lysinibacillus. Number of other bacterial lineages of Gram positive and negative bacteria which includes genera from phyla Firmicutes (Staphylococcus chromogenes D83360, Streptococcus pyogenes AB002521, Enterococcus faecalis AB012212, Clostridium populeti X71853, Listeria monocytogenes X56153), Actinobacteria (Corynebacterium diphtheria X84248, Mycobacterium tuberculosis X58890, Nocardia asteroids AF430019, Streptomyces lavendulae subsp. Lavendulae D85116), Alpha proteobacteria (Rhizobium leguminosarum U29386, Azospirillum lipoferum Z29619, Acetobacterium woodii X96954), Beta proteobacteria (Burkholderia cepacia U96927, Bordetella pertussis U04950) and Gamma Proteobacteria (Pseudomonas aeruginosa X06684, Escherichia coli X80725, Klebsiella pneumoniae X87276, Shigella dysenteriae X96966) have not shown any sequence homology (Table 2).

Table 2 % similarity of 463 bp sequence of 16S rRNA gene of type sp. ( Bacillus subtilis ) with 16S rRNA sequences of different AEFB strains (downloaded from NCBI), primer sequences in these AEFB strains, presence and absence of restriction enzyme site and position of specific fragment in AEFB strains

Multiple alignments of 463 bp sequences of different strains of Bacilli

Dendrogram prepared on the basis of alignment of 463 bp sequence has been given in Figure 2(a&b). Dendrogram prepared for 52 different strains of Bacillus and related genera (taken in our study) and some reference sequences downloaded from NCBI has been shown in Figure 2(a). Dendrogram has been divided in to 7 different groups (I-VII). Group I contains strains belonging to species Bacillus aquimaris and marisflavi. Strains belonging to genera Lysinibacillus (sphaericus and xylanilyticus) and Jeotgalibacillus are present in Group II. Group III contains strains belonging to Genera Terribacillus (sacharrophilus and goriensis), Bacillus subtilis sub sp. spizizinii and Bacillus licheniformis. Group IV contains strains belonging to species, Bacillus mycoides and Bacillus cereus. Group V contains strains belonging to genera Paenibacillus and Brevibacillus and strains belonging to species Bacillus simplex and Bacillus firmus have shared the group VI. Bacillus arsenicus has not shown any grouping with any other species or genera and Bacillus megaterium and Bacillus flexus have shared a single group VII while some strains of Bacillus megaterium, Bacillus flexus and Bacillus aryabhattai have not shown any grouping with any other strain. Second dendrogram (Figure 2b) containing 29 different closely related species has been divided in to two major clusters and only one species Bacillus siamensis GQ281299 has not shown any grouping with any other member. 7 bacterial species i.e. Bacillus aquaemaris AF483625, Bacillus marisflavi AF483624, Bacillus seohaeanensis AY667495, Bacillus vietnamensis AB099708, Bacillus flexus AB021185, Bacillus megaterium D16273, Bacillus koreensis AY667496 lie in one cluster. Other, 21 bacterial strains have shared the other major cluster.

Figure 2
figure 2

Dendrograms showing the phylogenetic relationship (a) 52 AEFB strains with reference sequences (b) 29 closely related species of genera Bacillus based on 463 bp long 16S rRNA sequences.

Discussion

When we use molecular approaches to study microbial communities then the use of universal primers is not fully successful in finding the clear picture of community. Various researchers have faced such type of problems as Van Elsas et al. (2002) faced the problem when they studied two 16S rDNA clone libraries (one from grassland and one from arable land) prepared with bacterial primers and most of the isolated strains were found to be belonging to phylum Proteobacteria and the number of clones related to Bacilli were very few. When the same microbial communities were studied by Garbeva et al. (2003), by using Bacillus specific primers then a lot of Bacillus clones were isolated. The problem faced by universal primers can be overcome by the use of group specific primers and various researchers have used group specific primers in their studies to overcome this problem. Heuer and Smalla (1997) used Actinomycete specific primers to monitor Actinomycete communities in the potato rhizosphere. Similarly Boon et al. (2001) used several group specific nested PCR systems to identify a lot of groups under same DGGE conditions. So the need of group specific primers is there to find out the diversity and identity of the members of a specific group.

In the present research we have focused on identification and classification of AEFB by using a specific fragment of 16S rRNA gene. So in the following session we have discussed the research related to identification and classification of bacilli by using 16S rRNA gene. As Many researchers have developed a lot of different Bacillus specific primers i.e. Goto et al. (2000), synthesized a Bacillus specific prime pair which was used to amplify a 275 bp sequence near the 5’ end of 16S rDNA gene and this sequence was very specific for identification and classification of Bacillus strains. Garbeva et al. (2003) developed a Bacillus specific primer pair (Bac F and Bac R). Specificity of both primers was checked independently and some species of Bacillus and other related genera have shown 100% similarity with primer Bac F and likewise the reverse primer has shown similarity with 31 different species of Bacillus and related genera. Vardhan et al. (2011) developed a primer pair specific for amplification of a hyper variable region in 16S rDNA gene of Bacillus and related genera.

In the present study we found that a restriction digestion product of 16S rRNA gene (460 bp) by HaeIII enzyme was specific for Bacillus and related genera. Position of this fragment was near the 3’ end of 16S rDNA gene and primer pair specific to this 463 bp fragment has been designed. Primer pair when checked for specificity has shown amplification of a 463 bp long fragment in strains belonging to genera Bacillus, Lysinibacillus, Terribacillus, Brevibacillus and Jeotgalibacillus. No any amplification was seen in two AEFB strains i.e. Bacillus arsenicus and Paenibacillus taiwanensis and 9 different strains of bacterial lineages other than AEFB (Figure 1c&d). Reason for no amplification of this fragment in Bacillus arsenicus and Paenibacillus taiwanensis is may be due to the reason that during the course of evolution these have faced some variations because of which the restriction enzyme sites for Hae III enzymes were deleted at that position and primer pair designed in the present study includes the restriction site which causes the non specificity for primer.

Results of our study indicate that primer pair designed here is specific for Bacillus and related genera and not for other bacterial lineages. Primer pair when checked for homology (in silico) has shown 100% homology with 16S rDNA sequences of 120 species related to genera Bacillus. Bacillus species which do not have shown 100% similarity of these primers have acquired anomalous positions in the classification based on 16S rRNA gene (Yarza et al. 2010). While some species i.e. B. pseudomycoides AF013121, B. ginsengihumi AB245378, B. acidiproducens EF379274, B. endophyticus, AF295302, B. benzoevorans, X60611, B. horneckiae EU86136 have shown anomalous positions with other bacterial lineages according to classification systems based on 16S rRNA gene (Yarza et al. 2010) in spite of having homology with primer pair in our study. Bacilli strains other than the genus Bacillus have also shown the primer pair similarity and these genera are Virgibacillus (7), Geobacillus (5), Filobacillus (1), Jeotgalibacillus (4) and Ureibacillus (5). Almost all the species checked for primer pair homology has shown 100% similarity except Virgibacillus pantothenticus D16275, Virgibacillus proomii and AJ012667. All of these genera belong to the family Bacillaceae except Jeotgalibacillus which belong to the family Planococcaceae. Bacillus related genera which don’t have shown primer pair similarity are Alicyclobacillus (7), Amphibacillus (5), Aneurinibacillus (5), Brevibacillus (16), Gracilibacillus (9) and Paenibacillus (5). Only a few members of these genera have shown homology with primer pair and these are Alicyclobacillus acidocaldarius AJ496806, Alicyclobacillus tolerans Z21979, Brevibacillus invocatus AF378232, Brevibacillus panacihum. Genera which do not have shown primer specificity belong to different species other than Bacillaceae except Amphibacillus, Gracilibacillus and Terribacillus. In our study genera belonging to family Bacillaceae have shown primer specificity and genera belonging to family other than Bacillaceae have not shown primer specificity except some genera which have shown primer specificity in reverse order.

Phylogenetic relationship based on 463 bp sequence of 52 bacilli strains (taken in our study) along with reference sequences (downloaded from NCBI) (Figure 2a) has shown that different bacterial strains belonging to same species and genera have shared a single group except some strains belonging to Bacillus megaterium, B. aryabhattai and B. flexus. As strains belonging to species Bacillus megaterium have not grouped in one cluster. Out of total 8 strains of B. megaterium, only two strains belonging to species B. megaterium have made grouping with B. flexus. Another 6 strains of B. megaterium and two strains of B. aryabhattai have not shown any grouping with any other strain, however all these eight strains lie below B. megaterium and B. flexus group. This shows that different strains of B. megaterium and B. aryabhattai (close relative of B. megaterium) have remarkable strain to strain genetic variations. Grouping of strains belonging to Bacillus related genera in between the strains related to Bacillus indicates that during the course of evolution these genera have been evolved from the older one genera i.e. Bacillus which is similar to the classifications according to others (Xu and Cote 2003; Yarza et al. 2010; Vardhan et al. 2011). Further the phylogenetic relationship of some closely related strains of genera Bacillus, sharing a single cluster in the all species living tree (Yarza et al. 2010) have shown the same phylogenetic relationship in our study (Figure 2b). The only exception is Bacillus siamensis GQ281299 which has not shown any grouping with any other Bacillus species. However, in all species living tree this strain has shown relationship with other Bacillus species which lie in the lower cluster in our study (Figure 2b).

From the present study we can conclude that the restriction digestion of 16S rRNA gene by HaeIII enzyme and amplification of 463 bp fragment with specific primers designed in our study are easy methods for identification of Bacillus and related genera. Further the sequence information and multiple alignment of 463 bp fragment of Bacillus and related genera have been proved to be a good identification and classification tool for Bacillus and related genera.

References

  • Ash C, Farrow AE, Wallbanks S, Collins MD: Phylogenetic heterogeneity of the genus Bacillus revealed by comparative analysis of small-subunit-ribosomal RNA sequences. Lett Appl Microbiol 1991, 13: 202-206.

    Article  Google Scholar 

  • Ash C, Priest FG, Collins D: Molecular identification of rRNA group 3 bacilli (Ash, Farrow, Wallbanks and Collins) using a PCR probe test. Proposal for the creation of a new genus Paenibacillus . Antonie van Leeuwenhoek 1993, 64: 253-260.

    Article  Google Scholar 

  • Boon N, Windt W, Verstraete W, Top EM: Evaluation of nested PCR-DGGE (denaturing gradient gel electropho-resis) with group-specific 16S rRNA primers for the analysis of bacterial communities from different waste water treatment plants. FEMS Microbiol Ecol 2001, 39: 101-112.

    Google Scholar 

  • Daffonchio D, Borin S, Consolandi A, Mora D, Manachini PL, et al.: 16S–23S rRNA internal transcribed spacers as molecular markers for the species of the 16S rRNA group I of the genus Bacillus . FEMS Microbiol Lett 1998, 163: 229-236.

    Google Scholar 

  • Daffonchio D, Borin S, Frova G, Manachini PL, Sorlini C: PCR fingerprinting of whole genomes: the spacers between the 16S and 23S rRNA genes and of intergenic tRNA gene regions reveal a different intraspecific genomic variability of Bacillus cereus and Bacillus licheniformis . Int J Syst Bacteriol 1998, 48: 107-116. 10.1099/00207713-48-1-107

    Article  Google Scholar 

  • De Clerck E, Van Mol K, Jannes G, Rossau R, de Vos P: Design of a 50 exonuclease-based real-time PCR assay for simultaneous detection of Bacillus licheniformis , members of the ' B. cereus group’ and B. fumarioli in gelatin. Lett Appl Microbiol 2004, 39: 109-115. 10.1111/j.1472-765X.2004.01550.x

    Article  Google Scholar 

  • Fortina MG, Pukall R, Schumann P, Mora D, Parini C, et al.: Ureibacillus gen. nov., a new genus to accommodate Bacillus thermosphericus (Anderson et al. 1995) emendation of Ureibacillus thermosphericus and description of Ureibacillus terrreneus sp. nov. Int J Syst Evol Microbiol 2001, 51: 447-455.

    Article  Google Scholar 

  • Garbeva P, van Veen JA, van Elsas JD: Predominant Bacillus spp. in Agricultural Soil under Different Management Regimes Detected via PCR-DGGE. Microb Ecol 2003, 45(3):302-316. 10.1007/s00248-002-2034-8

    Article  Google Scholar 

  • Goto K, Omura T, Hara Y, Sadaie Y: Application of the partial 16S rDNA sequence as an index for rapid identification of the species in the genus Bacillus . J Gen Appl Microbiol 2000, 46: 1-8. 10.2323/jgam.46.1

    Article  Google Scholar 

  • Gurtler V, Stanisich VA: New approaches for typing and identification of bacteria using the 16S–23S rDNA spacer region. Microbiology 1996, 142: 3-16. 10.1099/13500872-142-1-3

    Article  Google Scholar 

  • Heuer H, Smalla K: Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) for studying soil microbial com-munities. In Modern Soil Microbiology. Edited by: Van Elsas JD, Trevors JT, Wellington EMH. New York: Marcel Dekker; 1997:353-373.

    Google Scholar 

  • Heyndrickx M, Lebbe L, Kersters K, Devos P, Forsyth G: Virgibacillus : a new genus to accommodate Bacillus pantothenticus (Proom and Knight 1950). Emended description of Virgibacillus pantothenticus . Int J Syst Bacteriol 1998, 48: 99-106. 10.1099/00207713-48-1-99

    Article  Google Scholar 

  • Kadyan S, Panghal M, Kumar S, Singh K, Yadav JP: Assessment of functional and genetic diversity of aerobic endospore forming Bacilli from rhizospheric soil of Phyllanthus amarus L. World J Microbiol Biotechnol 2013. doi:10.1007/s11274-013-1323-3

    Google Scholar 

  • Kumar P, Khare S, Dubey RC: Diversity of Bacilli from Disease Suppressive Soil and their Role in Plant Growth Promotion and Yield Enhancement. New York Sci J 2012, 5(1):90-111.

    Google Scholar 

  • Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al.: Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23: 2947-2948. 10.1093/bioinformatics/btm404

    Article  Google Scholar 

  • Mandic-Mulec I, Prosser JI: Diversity of Endospore-forming Bacteria in Soil: Characterization and Driving Mechanisms. In Endospore-forming Soil Bacteria, Soil Biology 27. Edited by: Logan NA, De Vos P. Berlin Heidelberg: Springer-Verlag; 2011:31-59.

    Chapter  Google Scholar 

  • Nazina TN, Tourova TP, Poltaraus AB, Novikova EV, Grigoryan AA, et al.: Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen. nov. sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus , Bacillus thermocatenulatus , Bacillus thermoleovorans , Bacillus kaustophilus , Bacillus thermoglucosidasius , Bacillus thermodenitrificans to Geobacillus as Geobacillus stearothermophilus , Geobacillus thermocatenulatus , Geobacillus thermoleovorans , Geobacillus kaustophilu , Geobacillus thermoglucosidasius , Geobacillus thermodenitrificans . Int J Syst Evol Microbiol 2001, 51: 433-446.

    Article  Google Scholar 

  • Niimura Y, Koh E, Yanagida F, Suzuki KI, Komagata K, et al.: Amphibacillus xylanus gen. nov., a facultatively anaerobic spore foming xylin-digesting bacterium which lacks cytochrome, quinone, and catalase. Int J Syst Bacteriol 1990, 40: 297-301. 10.1099/00207713-40-3-297

    Article  Google Scholar 

  • Priest FG, Goodfellow M, Todd C: A numerical classification of the genus Bacillus . J Gen Microbiol 1988, 134: 1847-1882.

    Google Scholar 

  • Schlesner H, Lawson PA, Collins MD, Weiss N, Wehmeyer U, et al.: Filobacillus milensis gen. nov., a new halophilic spore-forming bacterium with Ornd- Glu-type peptidoglycan. Int J Syst Microbiol 2001, 51: 425-431.

    Article  Google Scholar 

  • Shida O, Takagi H, Kadowaki K, Yano H, Komagata K: Proposal for two new genera, Brevibacillus gen. Nov. and Aneurinibacillus gen. nov. Int J Syst Bacteriol 1996, 46: 939-946. 10.1099/00207713-46-4-939

    Article  Google Scholar 

  • Stackebrandt E, Swiderski J: From phylogeny to systematics: The dissection of the genus Bacillus . In Applications and systematics of Bacillus and relatives. Edited by: Berkeley R, Heyndrickx M, Logan N, De Vos P. Malden: Blackwell; 2002:822.

    Google Scholar 

  • Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance and Maximum Parsimony Method. Mol Biol Evol 2011, 28: 2731-2739. 10.1093/molbev/msr121

    Article  Google Scholar 

  • Van Elsas JD, Garbeva P, Salles J: Effects of agricultural measures on the microbial diversity of soil as related to suppression of soil-borne plant pathogens. Biodegradation 2002, 13: 29-40. 10.1023/A:1016393915414

    Article  Google Scholar 

  • Vardhan S, Kaushik R, Saxena AK, Arora DK: Restriction analysis and partial sequencing of the 16S rRNA gene as index for rapid identification of Bacillus species. Antonie Van Leeuwenhoek 2011, 99: 283-296. 10.1007/s10482-010-9487-4

    Article  Google Scholar 

  • Waino M, Tindall BJ, Schumann P, Ingvorsen K: Gracillbacillus gen. nov., with description of Graclibacillus holotolerence gen. nov., and Bacillus salexigens to the genus Salibacillus gen. nov., as Salibacillus salexigens comb. Nov. Int J syst bacteriol 1999, 49: 821-831. 10.1099/00207713-49-2-821

    Article  Google Scholar 

  • Wisotzkey JD, Jurtshuk P Jr, Fox GE, Deinhard G, Poralla K: Comparative sequence analyses on the 16S r RNA (rDNA) of Bacillus acidocaldarius , Bacillus acidoterrestris , and Bacillus cycloheptanicus and proposal for certain of a new genus, Alicyclobacillus gen. nov. Int J Syst Bacteriol 1992, 42: 263-269. 10.1099/00207713-42-2-263

    Article  Google Scholar 

  • Xu D, Cote JC: Phylogenetic relationships between Bacillus species and related genera inferred from comparison of 3’ end 16S rDNA and 5’ end 16S–23S ITS nucleotide sequences. Int J Syst Evol Microbiol 2003, 53: 695-704. 10.1099/ijs.0.02346-0

    Article  Google Scholar 

  • Yarza PW, Ludwig J, Euzeby R, Amann KH, Schleifer FO, et al.: Update of the All-Species Living Tree Project based on 16S and 23S rRNA sequence analyses. Syst Appl Microbiol 2010, 33: 291-299. 10.1016/j.syapm.2010.08.001

    Article  Google Scholar 

  • Yoon JH, Weiss N, Lee KC, Lee IS, Kang KH, et al.: Jeotgalibacillus alimentarius gen. nov., sp. Nov., a novel bacterium isolated from jeotgal with L-lysine in the cell wall, reclassification of Bacillus marinus (Ruger 1983) as Marinibacillus marinus gen. nov., comb. Nov. Int J Syst Evol Microbiol 2001, 51: 2087-2093. 10.1099/00207713-51-6-2087

    Article  Google Scholar 

Download references

Acknowledgements

Council of Scientific and industrial Research (CSIR), India is acknowledged to provide Senior Research Fellowship to author Sangeeta Kadyan. Authors are also thankful to Department of Science and Technology, New Delhi for providing financial grants under DST-FIST programme and UGC, New Delhi for financial grant under UGC-SAP scheme.

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Jaya Parkash Yadav.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contribution

SK carried out experimental research work. MP has contributed in interpretation of data and preparation of manuscript. KS has participated in sequence alignment. JPY has supervised the research work, prepared and edited the manuscript. All authors read and approved the final manuscript.

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2

Authors’ original file for figure 3

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 2.0 International License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and Permissions

About this article

Cite this article

Kadyan, S., Panghal, M., Singh, K. et al. Development of a PCR based marker system for easy identification and classification of aerobic endospore forming bacilli. SpringerPlus 2, 596 (2013). https://doi.org/10.1186/2193-1801-2-596

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/2193-1801-2-596

Keywords

  • AEFB
  • 16S rRNA gene
  • HaeIII
  • Specificity of fragment
  • PCR
  • In silico