Open Access

Development of a PCR based marker system for easy identification and classification of aerobic endospore forming bacilli

  • Sangeeta Kadyan1,
  • Manju Panghal1,
  • Khushboo Singh1 and
  • Jaya Parkash Yadav1Email author
SpringerPlus20132:596

https://doi.org/10.1186/2193-1801-2-596

Received: 3 August 2013

Accepted: 30 October 2013

Published: 9 November 2013

Abstract

Restriction fragment length analysis of 16S rRNA gene of 52 different aerobic endospore forming Bacilli (AEFB) strains with HaeIII enzyme has revealed the presence of a 460 bp long fragment in 50 AEFB strains. BLAST analysis revealed that the fragment was 463 bp long and it was located at 3’ end of 16S rRNA gene. Further specificity of this fragment for AEFB strains was checked by PCR and in silico methods. In PCR based method a primer pair (463 F and 463R) specific to this fragment was designed and this primer pair has shown amplification of 463 bp fragment in AEFB strains only. In in silico methods homology of primer pair and presence of restriction enzyme site in 16S rRNA genes were checked in 268 species of AEFB. Almost all species of AEFB have shown positive results for both of the tests. Further multiple alignments of 463 bp sequences of different species of AEFB have shown that it is a good marker for identification and classification of AEFB.

Keywords

AEFB16S rRNA geneHaeIIISpecificity of fragmentPCR In silico

Introduction

Aerobic endospore-formers have long been considered to be important components of the soil bacterial community (Mandic-Mulec and Prosser 2011). There is a great diversity of physiology among the aerobic spore formers. Their collective features include degradation of all substrates derived from plant and animal sources including cellulose, starch, pectin, proteins, agar, hydrocarbons and others, antibiotic production, nitrification, denitrification, nitrogen fixation, facultative lithotrophy, autotrophy, acidophily, alakliphily, psychrophily, thermophily and parasitism. Endospore formation, universally found in this group, is thought to be a strategy for survival even under adverse soil environment, where these bacteria predominate (Kumar et al. 2012). To get the beneficial effects of these AEFB it becomes very necessary to know how much diverse and abundant these microbes are in different soil ecosystems. Since 1990s various approaches based on phenotypic and genotypic characteristics have been applied to identify and classify the members of class Bacilli. Few decades before genus Bacillus was the only representative of class Bacilli among aerobic spore formers. Development of cultivation independent approaches have attracted microbiologist towards the molecular approaches for examining the microbes in a better way. Among different molecular methods, 16S rRNA gene sequencing is the best one. Since 1991, several new genera of aerobic spore formres like Amphibacillus (Niimura et al. 1990), Paenibacillus (Ash et al. 1991, 1993), Alicyclobacillus (Wisotzkey et al. 1992), Aneurinibacillus (Shida et al. 1996), Brevibacillus (Shida et al. 1996), Gracilibacillus (Waino et al. 1999), Salibacillus (Waino et al. 1999), Virgibacillus (Heyndrickx et al. 1998), Filobacillus (Schlesner et al. 2001), Geobacillus (Nazina et al. 2001), Jeotgalibacillus and Marinibacillus (Yoon et al. 2001) and Ureibacillus (Fortina et al. 2001) have been created based on this method. For phylogenetic arrangement of these newly discovered texa various markers based on 16S rDNA have been developed by different scientists (Priest et al. 1988; Ash et al. 1991; Gurtler and Stanisich 1996; Daffonchio et al. 1998a, b; Goto et al. 2000; Stackebrandt and Swiderski 2002; Xu and Cote 2003; De Clerck et al. 2004; Vardhan et al. 2011). Primer set developed by Garbeva et al. (2003) was found to be 100% specific for many of species of Bacillus and related genera. After a gap of years, Vardhan et al. (2011) developed a set of primers for identification of hyper variable region of 16S rDNA in different Bacillus species and partial sequencing of this hyper variable region behaves as an index for easy identification of species related to genera Bacillus.

With development of more advanced approaches to find cultivable and noncultivable diversity of microbes, lot of new species and genera, belonging to AEFB are discovering day by day. So, need of new marker systems is always there for proper identification and classification of these lineages. Hence the main objective of present study was to develop a simple and easy identification and classification tool for Bacillus and related genera which is an extension of research related to bacilli. The restriction digestion of amplified 16S rRNA gene by HaeIII enzyme has given a fragment of around 460 bp length in all species of Bacillus and related genera. Sequence information of this fragment (downloaded from NCBI) was used to find exact length of the fragment (463 bp) and to develop specific primers for amplification of this fragment in AEFB genera. Further sequence information and multiple alignment of 463 bp long sequences of different species of AEFB genera has revealed that this is an easy tool for identification and classification of the members of Bacillus and related genera. Another beneficial information provided by our study is that almost all species of Bacillus and related genera have restriction enzyme sites for Hae III enzyme which give a product of 460 bp. Restriction enzyme site for HaeIII are present at different positions in other bacterial lineages, therefore give product of different size after restriction digestion which clearly discriminate the Bacillus and related genera from others.

Material and methods

Bacterial strains

All of the bacterial strains used in the present study are Bacilli isolated from the rhizospheric soil of Phyllanthus amarus which were identified by 16S rRNA gene sequencing in our previous research work (Kadyan et al. 2013). Taxonomic information and accession numbers of isolates have been given in Table 1.
Table 1

Strain names and NCBI accession numbers of 52 AEFB strains isolated from rhizospheric soil of Phyllanthus amarus

Strain code

Bacterial isolate

Accession number

Strain code

Bacterial isolate

Accession number

1.P3

B. marisflavi JP44SK40

JX129227

15.P2

B. subtilis subsp. spizizenii JP44SK24

JX144714

2.P1

B. megaterium JP44SK1

JX144691

16.P1

B. simplex JP44SK25

JX144715

2.P2

B. megaterium JP44SK2

JX144692

16.P2

B. simplex JP44SK26

JX144716

3.P1

Lysinibacillus sphaericus JP44SK3

JX144693

17.P3

B. cereus JP44SK27

JX144717

3.P2

Lysinibacillus sphaericus JP44SK4

JX144694

18.P3

B. aquimaris JP44SK28

JX144718

3.P3

B. megaterium JP44SK5

JX144695

19.P1

B. simplex JP44SK29

JX144719

4.P1

B. licheniformis JP44SK6

JX144696

19.P2

B. simplex JP44SK30

JX144720

5.P3

Paenibacillus taiwanensis JP44SK7

JX144697

20.P1

B. simplex JP44SK31

JX144721

6.P1

B. mycoides JP44SK8

JX144698

20.P2

B. simplex JP44SK32

JX144722

6.P3

B. mycoides JP44SK9

JX144699

23.P1

B. cereus JP44SK33

JX144723

7.P1

B. aryabhattai JP44SK11

JX144701

23.P2

B. cereus JP44SK34

JX144724

7.P2

B. megaterium JP44SK10

JX144700

23.P3

B. megaterium JP44SK35

JX144725

7.P3

Lysinibacillus xylanilyticu s JP44SK52

JX155769

24.P1

B. mycoides JP44SK36

JX144726

8.P1

B. simplex JP44SK12

JX144702

24.P3

B. cereus JP44SK37

JX144727

8.P2

B. simplex JP44SK13

JX144703

25.P2

B. aryabhattai JP44SK38

JX144728

8.P3

B. arsenicus JP44SK14

JX144704

26.P3

B. megaterium JP44SK39

JX144729

9.P3

B. marisflavi JP44SK15

JX144705

27.P1

Brevibacillus laterosporus JP44SK41

JX155758

10.P3

B. firmus JP44SK16

JX144706

27.P3

B. cereus JP44SK42

JX155759

11.P1

B. firmus JP44SK17

JX144707

30.P1

B. cereus JP44SK43

JX155760

11.P3

B. megaterium JP44SK18

JX144708

31.P3

Jeotgalibacillus sp. JP44SK56

KC012993

12.P3

B. flexus JP44SK19

JX144709

36.P3

B. cereus JP44SK44

JX155761

13.P1

B. megaterium strain JP44SK21

JX144711

37.P3

B. cereus JP44SK45

JX155762

13.P3

B. firmus JP44SK20

JX144710

38.P3

Terribacillus saccharophilus JP44SK46

JX155763

14.P2

Brevibacillus laterosporus JP44SK51

JX155768

41.P3

Terribacillus goriensis JP44SK47

JX155764

14.P3

B. cereus JP44SK22

JX144712

43.P3

B. cereus JP44SK49

JX155766

15.P1

B. subtilis subsp. spizizenii JP44SK23

JX144713

44.P3

B. mycoides JP44SK50

JX155767

16S rRNA gene amplification and restriction digestion by HaeIII enzyme

Gene coding for 16S rRNA gene of all of the 52 AEFB strains along with 10 reference strains (Shigella Flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumonia ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marcescens MTCC4822, Bacillus subtilis MTCC7193, and Staphylococcus aureus MTCC7443) was amplified by using universal primers i.e. B27f (5'-AGAGTTTGATCCTGGCTCAG-3') and U1492R (5'- GGTTACCTTGTTACGACTT-3') in thermal cycler (Biorad). Further reaction mixture for restriction digestion was prepared by mixing 8.5 μl of purified PCR products, 5 U of restriction endonuclease, HaeIII (Fermentas) and 1.0 μl of 10X recommendation buffer. Reaction mixture was incubated overnight in water bath at 37°C. Restriction digested DNA was analysed by horizontal electrophoresis in 2% agarose gels with 100 bp DNA marker. The gels were visualized on a gel documentation system (Alpha Innotech). Photograph of gel has been shown in Figure 1(a&b).
Figure 1

Gel photograph showing ARDRA pattern of 52 AEFB strains (a) Gel photograph of ARDRA pattern of 52 AEFB strains digested with Hae III restriction enzyme.(b) Gel photograph of ARDRA pattern of 10 reference strains digested with Hae III restriction enzyme. (c) Gel photograph of PCR amplified 463 bp fragments in 52 strains of AEFB. (d) Gel photograph of PCR amplification result of 463 bp fragments in 10 reference strains. (a) Lane M - 100 bp DNA marker. Lanes 1–52 indicate bacterial strain codes (2.P1, 3.P1, 4.P1, 6.P1, 7.P1, 8.P1, 11.P1, 13.P1, 15.P1, 16.P1, 19.P1, 20.P1, 23.P1, 24.P1, 27.P1, 30.P1, M, 2.P2, 3.P2, 7.P2, 8.P2, 15.P2, 16.P2, 19.P2, 20.P2, 23.P2, 14.P2, M, 1.P3, 3.P3, 5.P3, 6.P3, 7.P3, 8.P3, 9.P3, 10.P3, 11.P3, 12.P3, 13.P3, 14.P3, 17.P3, 18.P3, 24.P3, M, 23.P3, 25.p2, 26.P3, 27.P3, 31.P3, 36.P3, 37.P3, 38.P3, 41.P3, 43.p3, 44.p3). (b) Lane M -100 bp DNA marker, lane 1–10 Shigella flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumoniae ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marrcescens MTCC4822, Bacillus subtilis MTCC7193, Staphylococcus aureus MTCC7443. Arrow indicates the size of 460 bp fragment in Bacillus subtilis MTCC7193. (c): M - 100 bp DNA marker, lane 1–52 (1.P3, 2.P1, 2.P2, 3.P1, 3.P2, 3.P3, 4.P1, 5.P3, 6.P1, 6.P3, 7.P1, 7.P2, 7.P3, 8.P1, 8.P2, 8.P3, 9.P3, 10.P3, 11.P1, 11.P3, 12.P3, 13.P1, 13.P3, 14.P2, 14.P3, 15.P1, 15.P2, 16.P1, 16.P2, 17.P3, 18.P3, 19.P1, 19.P2, 20.P1, 20.P2, 23.P1, 23.P2, 23.P3, 24.P1, 24.P3, 25.P2, 26.P3, 27.P1, 27.P3, 30.P1, 31.P3, 36.P3, 37.P3, 38.P3, 41.P3, 43.P3, 44.P3). Arrow indicates the size of fragment. (d): Bacterial strain Bacillus subtilis MTCC7193, present in lane no. 3 has shown amplification of 463bp fragment and other reference strains have not shown any amplification. Arrow indicates the size of fragment compared with marker of 100 bp present in lane M.

Restriction pattern analysis and designing of oligonucleotide primers

Restriction pattern analysis of HaeIII digested 16S rRNA gene has shown the presence of a fragment having length around 460 bp (Figure 1a) in all of the bacterial species belonging to Bacillus and related genera (except Bacillus arsenicus, Paenibacillus taiwanensis and 9 reference strains related to other bacterial lineages) (Figure 1b). On the basis of these observations it was assumed that this 460 bp fragment was specific for Bacillus and related genera. To find out the exact location and sequence information of this fragment, 16S rRNA gene sequence of all of the Bacillus isolates taken in our study was downloaded from NCBI gene bank database. All of the 16S rRNA gene sequences were checked for HaeIII enzyme cut sites (GG↓CC). Sequence between two cut sites having length of around 460 bp was found in all of the 16S rRNA gene sequences at same position. Further length of this region was found to be 461-463 bp. Primer pair specific to this region was designed by using software, Primer 3.0 and further synthesized from the facility available at Eurofins Genomics India Pvt. Ltd., Bangalore.

Sequence specificity of primer pair and occurrence of restriction enzyme site

The specificity of oligonucleotide primers was checked by PCR amplification of the 463 bp fragment in all of the 52 AEFB isolates along with 10 reference strains (Shigella Flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumonia ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marcescens MTCC4822, Bacillus subtilis MTCC7193, and Staphylococcus aureus MTCC7443). Reaction conditions for PCR were, initial denaturation at 94°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 20 seconds, extension at 72°C for 30 seconds and at last final extension at 72°C for 7 minutes. Theoretically primer pair was checked for its specificity in 16S rRNA gene sequences (downloaded from NCBI) in different species of Bacillus and related genera i.e. 153 different species of Bacillus, 20 Virgibacillus, 15 Geobacillus, 1 Filobacillus, 4 Jeotgalibacillus, 5 Ureibacillus, 21 Alicyclobacillus, 5 Amphibacillus, 5 Aneurinibacillus, 16 Brevibacillus, 9 Gracilibacillus, 5 Paenibacillus, 5 Lysinibacillus and 4 Terribacillus. A number of other bacterial lineages of Gram positive and negative bacteria were also checked for primer specificity which includes genera from phylum Firmicutes (other than Bacilli), Actinobacteria, Alpha Proteobacteria, Beta Proteobacteria and Gamma Proteobacteria.

Multiple alignment of 463 bp long partial 16S rDNA sequence of different species of Bacilli

To check the ability of marker for classification of Bacilli, we have done the multiple alignments of specific, 463 bp long sequences of 16S rRNA gene of 52 strains (taken in our study) with the reference sequences downloaded from NCBI. Multiple alignment of very closely related species of genus Bacillus (29 different species of Bacillus) lying in two nearby clusters in all species living tree by Yarza et al. (2010) has also been done to check the differentiation ability of this sequence. Software Clustal X 2.0 (Larkin et al. 2007) was used for alignment of different sequences and further alignment file was used in molecular evolutionary genetic analysis software version 5.1 (MEGA 5.1) (Tamura et al. 2011) for construction of phylogenetic tree.

Results

Oligonucleotide primers

Bacillus and related genera specific primers designed in our study were named as 463 F (5’CTAAAACTCAAAGGAATTGACG3’) and 463R (5’AATACGTTCCCGGGCCTT3’).

PCR amplification of 463 bp sequence

PCR amplification has confirmed the specificity of the primer pair in 52 AEFB strains and 10 reference strains. Out of total, 50 strains belonging to Bacillus and related genera have shown the amplification of the specific region. However, the region was not amplified in Bacillus arsenicus, Paenibacillus taiwanensis and 9 reference strains (Figure 1c & d).

Sequence homology of primers in 16S rRNA gene sequences of Bacillus and related genera

Primer sequences were found to be 100% similar with the 16S rRNA gene sequences (downloaded from NCBI) of 120 species of genera Bacillus, 13 Geobacillus, 1 Filobacillus, 4 Jeotgalibacillus, 5 Ureibacillus, 7 Alicyclobacillus, 2 Brevibacillus and 5 Lysinibacillus. Number of other bacterial lineages of Gram positive and negative bacteria which includes genera from phyla Firmicutes (Staphylococcus chromogenes D83360, Streptococcus pyogenes AB002521, Enterococcus faecalis AB012212, Clostridium populeti X71853, Listeria monocytogenes X56153), Actinobacteria (Corynebacterium diphtheria X84248, Mycobacterium tuberculosis X58890, Nocardia asteroids AF430019, Streptomyces lavendulae subsp. Lavendulae D85116), Alpha proteobacteria (Rhizobium leguminosarum U29386, Azospirillum lipoferum Z29619, Acetobacterium woodii X96954), Beta proteobacteria (Burkholderia cepacia U96927, Bordetella pertussis U04950) and Gamma Proteobacteria (Pseudomonas aeruginosa X06684, Escherichia coli X80725, Klebsiella pneumoniae X87276, Shigella dysenteriae X96966) have not shown any sequence homology (Table 2).
Table 2

% similarity of 463 bp sequence of 16S rRNA gene of type sp. ( Bacillus subtilis ) with 16S rRNA sequences of different AEFB strains (downloaded from NCBI), primer sequences in these AEFB strains, presence and absence of restriction enzyme site and position of specific fragment in AEFB strains

Sr. no.

Name of bacteria

NCBI accession no.

Sequence of primer pair in different AEFB strains

% similarity of 463 bp sequence and presence of restriction enzyme site

Position of 463 bp sequence in 16S rRNA gene

1

Alicyclobacillus sacchari

AB264020

AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

913-1374

2

Alicyclobacillus acidiphilus

AB076660

AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%-

913-1374

3

Alicyclobacillus acidoterrestris

AB042057

AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

910-1371

4

Alicyclobacillus hesperidum

AJ133633

AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

884-1345

5

Alicyclobacillus fastidiosus

AB264021

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

910-1371

6

Alicyclobacillus vulcanalis

AY425985

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

894-1355

7

Alicyclobacillus sendaiensis

AB084128

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

885-1346

8

Alicyclobacillus contaminans

AB264026

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

925-1386

9

Alicyclobacillus acidocaldarius subsp. acidocaldarius (Type sp)

AJ496806

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

87%+

902-1363

10

Alicyclobacillus aeris

FM179383

AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

911-1372

11

Alicyclobacillus pomorum

AB089840

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

911-1372

12

Alicyclobacillus disulfidooxidans

AB089843

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

85%+

911-1372

13

Alicyclobacillus tolerans

Z21979

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

87%-

906-1365

14

Alicyclobacillus ferrooxydans

EU137838

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

913-1374

15

Alicyclobacillus cycloheptanicus

AB042059

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

911-1372

16

Alicyclobacillus macrosporangiidus

AB264025

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

87%-

927-1388

17

Alicyclobacillus kakegawensis

AB264022

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

86%+

924-1385

18

Alicyclobacillus shizuokensis

AB264024

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

87%+

924-1385

19

Alicyclobacillus herbarius

AB042055

AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

87%+

924-1385

20

Alicyclobacillus pohliae

AJ564766

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

88%+

904-1363

21

Alicyclobacillus tolerans

Z21979

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

87%-

906-1365

22

Amphibacillus sediminis

AB243866

AATACGTTCCCGGGTC TT CTGAAACTCAAAA GAATTGACG

96%-

928-1386

23

Amphibacillus jilinensis,

FJ169626

AATACGTTCCCGGGTC TT CTGAAACTCAAAA GAATTGACG

95%-

948-1406

24

Amphibacillus tropicus

AF418602

AATACGTTCCCGGGTC TT CTGAAACTCAAAA GAATTGACG

95%-

905-1362

25

Amphibacillus fermentum

AF418603

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT

93%-

910-1368

26

Amphibacillus xylanus, type sp.

D82065

AATACGTTCCCGGGTC TT CTGAAACTCAAAA GAATTGACG

94%-

948-1406

27

Aneurinibacillus aneurinilyticus type sp.

X94194

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

91%-

903-1369

28

Aneurinibacillus migulanus

X94195

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT

90%-

903-1359

29

Aneurinibacillus danicus

AB112725

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT

91%-

903-1354

30

Aneurinibacillus thermoaerophilus

X94196

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT

92%-

904- 1361

31

Aneurinibacillus terranovensis

AJ715385

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT

91%-

897-1353

32

Brevibacillus centrosporus

D78458

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

917-1377

33

Brevibacillus choshinensis

AB112713

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

894-1354

34

Brevibacillus reuszeri

AB112715

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

894-1354

35

Brevibacillus parabrevis

AB112714

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

894-1354

36

Brevibacillus brevis type sp.

AB271756

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

896-1356

37

Brevibacillus formosus

AB112712

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

894-1354

38

Brevibacillus agri

AB112716

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

895-1355

39

Brevibacillus limnophilus

AB112717

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

909-1369

40

Brevibacillus invocatus

AF378232

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

896-1356

41

Brevibacillus panacihumi

EU383033

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

902-1362

42

Brevibacillus borstelensis

AB112721

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

894-1354

43

Brevibacillus ginsengisoli

AB245376

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

873-1333

44

Brevibacillus laterosporus

D16271

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

896-1356

45

Brevibacillus fluminis

EU375457

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

896-1356

46

Brevibacillus levickii

AJ715378

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

897-1357

47

Brevibacillus thermoruber

Z26921

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

915-1376

48

Gracilibacillus lacisalsi

DQ664540

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

94%+

933-1393

49

Gracilibacillus thailandensis

FJ182214

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

94%+

942-1402

50

Gracilibacillus saliphilus

EU784646

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

94%+

917-1377

51

Gracilibacillus orientalis

AM040716

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

93%+

931-1391

52

Gracilibacillus dipsosauri

AB101591

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

95%+

923-1383

53

Gracilibacillus ureilyticus

EU709020

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

95%+

923-1383

54

Gracilibacillus boraciitolerans

AB197126

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

94%+

935-1395

55

Gracilibacillus halotolerans type sp.

AF036922

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

94%+

934-1394

56

Gracilibacillus halophilus

EU135704

CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT

94%+

924-1384

57

Paenibacillus polymyxa type sp.

D16276

AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG

90%-

913-1375

58

Paenibacillus antarcticus

AJ605292

AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG

90%-

915-1374

59

Paenibacillus macquariensis subsp. macquariensis

X60625

AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG

90%-

935-1394

60

Paenibacillus macquariensis subsp. defensor

AB360546

AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG

90%+

936-1395

61

Paenibacillus glacialis

EU815294

AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG

91%-

934-1393

62

Virgibacillus pantothenticus type sp.

D16275

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

95%-

919-1375

63

Virgibacillus proomii

AJ012667

CTGAAACTCAAAAGA ATTGACG AATACGTTCCCGGGTC TT

95%-

916-1372

64

Virgibacillus salexigens

Y11603

CTGAAACTCAAAAG AATTNACG AATACGTTCCCGGGCCTT

95%+

921-1379

65

Virgibacillus marismortui

AJ009793

AATACGTTCCCGGGCCTT CTGAAACTCAAAAG AATTGACG

95%+

947-1407

66

Virgibacillus salarius

AB197851

AATACGTTCCCGGGCCTT CTGAAACTCAAAA GAATTGACG

95%+

949-1409

67

Virgibacillus olivae

DQ139839

AATACGTTCCCGGGCCTT CTGAAACTCAAAAG AATTGACG

95%+

948-1409

68

Virgibacillus halodenitrificans

AY543169,

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

926-1386

69

Virgibacillus koreensis

AY616012

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

97%+

926-1386

70

Virgibacillus halophilus

AB243851

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

94%+

926-1386

71

Virgibacillus sediminis

AY121430

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

96%-

946-1406

72

Virgibacillus xinjiangensis

DQ664543

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

96%-

894-1354

73

Virgibacillus chiguensis

EF101168

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

96%-

919-1375

74

Virgibacillus dokdonensis

AY822043

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGT CTT

96%-

927-1383

75

Virgibacillus carmonensis

AJ316302

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

925-1385

76

Virgibacillus necropolis

AJ315056

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

925-1385

77

Virgibacillus arcticus

EF675742

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

809- 1269

78

Virgibacillus byunsanensis

FJ357159

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

923-1383

79

Virgibacillus salinus

FM205010

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

932-1392

80

Virgibacillus subterraneus

FJ746573

AATACGTTCCCGGC CCTT CTGAAACTCAAAAG AATTGACG

91%+

905-1362

81

Virgibacillus kekensis

AY121439

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

945-1405

82

Geobacillus stearothermophilus type sp.

AB021196,

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

912-1376

83

Geobacillus kaustophilus

X60618

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

933-1390

84

Geobacillus lituanicus

AY044055

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

933-1397

85

Geobacillus thermoleovorans

Z26923

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

918-1382

86

Geobacillus thermocatenulatus

AY608935

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

940-1404

87

Geobacillus jurassicus

AY312404

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

915-1379

88

Geobacillus uzenensis

AF276304

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

907-1370

89

Geobacillus subterraneus

AF276306

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

931-1395

90

Geobacillus thermodenitrificans

AY608961

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

939-1409

91

Geobacillus debilis

AJ564616

AATACGTTCT CGGGCCTT CTGAAACTCAAAGGAATTGACG

91%-

936-1398

92

Geobacillus toebii

AF326278

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

910-1374

93

Geobacillus thermoglucosidasius

AY608981

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

939-1405

94

Geobacillus caldoxylosilyticus

AF067651

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

925-1389

95

Geobacillus tepidamans

AY563003

G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

872-1334

96

Geobacillus vulcani

AJ293805

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

920-1384

97

Filobacillus milosensis

AJ238042,

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

915-1375

98

Jeotgalibacillus alimentarius.

AF281158

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

911-1373

99

Jeotgalibacillus salarius

EU874389

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

910-1372

100

Jeotgalibacillus campisalis

AY190535

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

908-1370

101

Jeotgalibacillus marinus

AJ237708

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

918-1380

102

Ureibacillus thermosphaericus

AB101594

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

931-1392

103

Ureibacillus composti

DQ348071

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

929-1390

104

Ureibacillus thermophilus

DQ348072

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

931-1392

105

Ureibacillus suwonensis

AY850379

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%-

918-1379

106

Ureibacillus terrenus

AJ276403

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%-

900-1361

107

Lysinibacillus boronitolerans

AB199591

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

898-1360

108

Lysinibacillus xylanilyticus

FJ477040

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

826-1288

109

Lysinibacillus fusiformis

AJ310083

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

920-1382

110

Lysinibacillus sphaericus

AJ310084

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

920-1382

111

Lysinibacillus parviboronicapiens

AB300598

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

910-1372

112

Terribacillus goriensis

DQ519571

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

94%+

895-1355

113

Terribacillus saccharophilus

AB243845

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

94%+

922-1382

114

Terribacillus halophilus

AB243849

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

922-1382

115

Terribacillus aidingensis

FJ386524

CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT

95%+

922-1382

116

Bacillus massiliensis

AY677116

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

93%+

908-1370

117

Bacillus cecembensis

AM773821

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

93%+

931-1393

118

Bacillus odysseyi

AF526913

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

93%+

931-1393

119

Bacillus decisifrondis

DQ465405

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

85%+

843-1305

120

Bacillus psychrodurans

AJ277984

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

95%-

918-1380

121

Bacillus psychrotolerans

AJ277983

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

95%-

903-1365

122

Bacillus insolitus

AM980508

GAGGGGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

94%+

917-1378

123

Bacillus beijingensis

EF371374

AATACGTTCCCGGGTCTT CTGAAACTCAAAGGAATTGACG

96%-

929-1387

124

Bacillus ginsengi

EF371375

AATACGTTCCCGGGTCTT CTGAAACTCAAAGGAATTGACG

97%-

929-1387

125

Bacillus aquimaris

AF483625

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

99%+

910-1372

126

Bacillus vietnamensis

AB099708

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

98%+

903-1365

127

Bacillus marisflavi

AF483624

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

100%+

909-1371

128

Bacillus seohaeanensis

AY667495

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

98%+

872-1334

129

Bacillus mycoides

AB021192

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

97%+

907-1367

130

Bacillus weihenstephanensis

AB021199

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

97%+

925-1385

131

Bacillus thuringiensis

D16281

AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG

97%+

911-1371

132

Bacillus pseudomycoides

AF013121

CTGAAACTCAAAGGAT TTGACG AATACGTTCCCGGGCCTT

95%+

932-1392

133

Bacillus funiculus

AB049195

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

919-1379

134

Bacillus panaciterrae

AB245380

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

904-1364

135

Bacillus flexus

AB021185

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

923-1385

136

Bacillus megaterium

D16273

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

910-1372

137

Bacillus koreensis

AY667496

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

847-1309

138

Bacillus aerius

AJ831843

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

922-1382

139

Bacillus aerophilus

AJ831844

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

927-1387

140

Bacillus stratosphericus

AJ831841

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

927-1387

141

Bacillus sonorensis

AF302118

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

908-1368

142

Bacillus amyloliquefaciens

AB255669

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

909-1369

143

Bacillus siamensis

GQ281299

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%-

931-1352

144

Bacillus methylotrophicus

EU194897

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

898-1358

145

Bacillus subtilis subsp. subtilis

AJ276351

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

919-1379

146

Bacillus subtilis subsp. spizizenii

AF074970

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

907-1367

147

Bacillus vallismortis

AB021198

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

924-1384

148

Bacillus mojavensis

AB021191

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

920-1380

149

Bacillus atrophaeus

AB021181

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

909-1369

150

Bacillus pumilus

AY876289

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

879-1339

151

Bacillus safensis

AF234854

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

879-1339

152

Bacillus altitudinis

AJ831842

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

934-1394

153

Bacillus ginsengihumi

AB245378

TT GAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%-

914-1376

154

Bacillus acidiproducens

EF379274

TT GAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%-

879-1341

155

Bacillus acidicola

AF547209

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

99%+

934-1396

156

Bacillus oleronius

AY988598

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

934-1396

157

Bacillus sporothermodurans

U49078

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

904-1366

158

Bacillus carboniphilus

AB021182

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

910-1372

159

Bacillus chungangensis

FJ514932

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

890-1352

160

Bacillus endophyticus

AF295302

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

96%-

906-1362

161

Bacillus isabeliae

AM503357

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

912-1372

162

Bacillus shackletonii

AJ250318

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

909-1371

163

Bacillus circulans

AY043084

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

902-1364

164

Bacillus nealsonii

EU656111

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

928-1390

165

Bacillus korlensis

EU603328

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

889-1351

166

Bacillus siralis

AF071856

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

905-1367

167

Bacillus benzoevorans

X60611

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

95%-

931-1386

168

Bacillus firmus

D16268

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

907-1369

169

Bacillus infantis

AY904032

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

871-1333

170

Bacillus oceanisediminis

GQ292772

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

861-1323

171

Bacillus kribbensis

DQ280367

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%-

919-1381

172

Bacillus horneckiae

EU861362

TT GAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

796-1258

173

Bacillus badius

X77790

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%-

913-1370

174

Bacillus smithii

Z26935

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

924-1383

175

Bacillus aeolius

AJ504797

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%-

901-1361

176

Bacillus coagulans

AB271752

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%-

911-1373

177

Bacillus alveayuensis

AY605232

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

934-1396

178

Bacillus thermoamylovorans

L27478

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

92%+

930-1391

179

Bacillus fordii

AY443039

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

892-1354

180

Bacillus fortis

AY443038

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

927-1389

181

Bacillus farraginis

AY443036

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

838-1300

182

Bacillus galactosidilyticus

AJ535638

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

904-1367

183

Bacillus ruris

AJ535639

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%-

901-1363

184

Bacillus lentus

AB021189

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

928-1390

185

Bacillus novalis

AJ542512

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

908-1370

186

Bacillus vireti

AJ542509

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

908-1370

187

Bacillus bataviensis

AJ542508

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

908-1370

188

Bacillus drentensis

AJ542506

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

844-1306

189

Bacillus soli

AJ542513

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

908-1370

190

Bacillus fumarioli

AJ250056

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

909-1371

191

Bacillus niacini

AB021194

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

921-1383

192

Bacillus pocheonensis

AB245377

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

910-1372

193

Bacillus boroniphilus

AB198719

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

930-1392

194

Bacillus selenatarsenatis

AB262082

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

870-1332

195

Bacillus jeotgali

AF221061

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

908-1370

196

Bacillus thioparans

DQ371431

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

908-1370

197

Bacillus foraminis

AJ717382

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

922-1384

198

Bacillus canaveralius

DQ870688

CTGAAACTCAAAGGAATTGACG SEQUENEWAS SHORT

97%

887-1323

199

Bacillus infernus

U20385

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTN

95%+

921-1383

200

Bacillus methanolicus

AB112727

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

909-1372

201

Bacillus butanolivorans

EF206294

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

914-1380

202

Bacillus simplex

AJ439078

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

920-1379

203

Bacillus muralis

AJ316309

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

909-1371

204

Bacillus psychrosaccharolyticus

AB021195

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

900-1362

205

Bacillus asahii

AB109209

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

909-1373

206

Bacillus indicus

AJ583158

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

918-1381

207

Bacillus cibi

AY550276

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

896-1358

208

Bacillus idriensis

AY904033

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

889-1351

209

Bacillus niabensis

AY998119

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

904-1366

210

Bacillus fastidiosus

X60615

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

930-1386

211

Bacillus litoralis

AY608605

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

908-1370

212

Bacillus herbersteinensis

AJ781029

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

908-1370

213

Bacillus galliciensis

FM162181

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

908-1370

214

Bacillus alkalitelluris

AY829448

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

911-1373

215

Bacillus humi

AJ627210

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%

910-1372

216

Bacillus halmapalus

X76447

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

98%+

908-1370

217

Bacillus horikoshii

AB043865

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

929-1391

218

Bacillus cohnii

X76437

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

910-1372

219

Bacillus acidiceler

DQ374637

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

916-1376

220

Bacillus luciferensis

AJ419629

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

909-1369

221

Bacillus azotoformans

AB363732

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

909-1370

222

Bacillus taeanensis

AY603978

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

917-1378

223

Bacillus macauensis

AY373018

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

88-1350

224

Bacillus rigui

EU939689

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%-

903-1365

225

Bacillus solisalsi

EU046268

CTGAAACTCAAAA GGAATTGACG AATACGTTCCCGGGCCTT

95%-

887-1349

226

Bacillus gelatini

AJ551329

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

909-1371

227

Bacillus arsenicus

AJ606700

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%-

928-1390

228

Bacillus barbaricus

AJ422145

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%-

882-1342

229

Bacillus algicola

AY228462

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

931-1393

230

Bacillus hwajinpoensis

AF541966

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

909-1371

231

Bacillus decolorationis

AJ315075

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

909-1371

232

Bacillus okuhidensis

AB047684

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

874-1335

233

Bacillus lehensis

AY793550

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

95%-

939-1395

234

Bacillus oshimensis

AB188090

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

95%-

937-1393

235

Bacillus patagoniensis

AY258614

AATACGTTCCCGGGTC TT T TGAAACTCAAAGGAATTGACG

95%-

913-1369

236

Bacillus clausii

X76440

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

95%-

913-1369

237

Bacillus gibsonii

X76446

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

912-1372

238

Bacillus murimartini

AJ316316

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

913-1373

239

Bacillus plakortidis

AJ880003

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

906-1366

240

Bacillus pseudalcaliphilus

X76449

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

909-1371

241

Bacillus trypoxylicola

AB434284

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

911-1373

242

Bacillus alcalophilus

X76436

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

909-1371

243

Bacillus bogoriensis

AY376312

CTGAAACTCAAAGGAATTGAGC AATACGTTCCCGGGCCTT

97%+

911-1374

244

Bacillus akibai

AB043858

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

950-1411

245

Bacillus krulwichiae

AB086897

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

912-1374

246

Bacillus okhensis

DQ026060

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

916-1378

247

Bacillus wakoensis

AB043851

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

930-1392

248

Bacillus hemicellulosilyticus

AB043846

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

940-1402

249

Bacillus macyae

AY032601cpf

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

916-1378

250

Bacillus alkalinitrilicus

EF422411

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

919-1381

251

Bacillus pseudofirmus

X76439

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

97%+

910-1372

252

Bacillus qingdaonensis

DQ115802

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

913-1375

253

Bacillus halochares

AM982516

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%-

881-1343

254

Bacillus aidingensis

DQ504377

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%-

946-1407

255

Bacillus salarius

AY667494

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

858-1320

256

Bacillus persepolensis

FM244839

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

940-1402

257

Bacillus agaradhaerens

X76445

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGT CTT

96%+

925-1385

258

Bacillus neizhouensis

EU925618

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

96%+

905-1367

259

Bacillus beveridgei

FJ825145

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

944-1409

260

Bacillus chagannorensis

AM492159

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%+

945-1407

261

Bacillus saliphilus

AJ493660

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

919-1381

262

Bacillus aurantiacus

AJ605773

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

929-1381

263

Bacillus vedderi

Z48306

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%-

905-1367

264

Bacillus cellulosilyticus

AB043852

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%-

924-1386

265

Bacillus clarkii

X76444

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

95%+

926-1328

266

Bacillus polygoni

AB292819

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

94%-

945-1408

267

Bacillus horti

D87035

CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

93%+

923-1378

268

Bacillus mannanilyticus

AB043864

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

96%-

955-1413

 

Actinobacteria (High GC content gram positive bacteria)

    

269

Corynebacterium diphtheriae

X84248

CTA AAACTCAAAGGAATTGACG AATACGTNCCCGGGCCTT

83%-

880-1341

270

Mycobacterium tuberculosis

X58890

CTAAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

85%-

1541-2002

271

Nocardia asteroides

AF430019

CTA AAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

84%-

875-1376

272

Streptomyces lavendulae subsp. lavendulae

D85116

CTA AAACTCANAGGAATTGACG AATACGTTCCCGGGCCTT

81%-

893-1361

 

Low GC content Firmicutes (gram +ve)

    

273

Staphylococcus chromogenes

D83360

AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG

92%+

913-1371

274

Streptococcus pyogenes

AB002521

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

89%+

890-1350

275

Enterococcus faecalis

AB012212

T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

91%+

939-1395

276

Clostridium populeti

X71853

A TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT

86%-

903-1359

277

Listeria monocytogenes.

X56153

AATACGTTCCCGGGCCTN T TGAAACTCAAAGGAATTGACG

94%+

936-1392

 

Alpha proteobacteria

    

278

Rhizobium leguminosarum

U29386

TTA AAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

86%-

913-1371

279

Azospirillum lipoferum

Z29619

TTA AAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT

84%-

845-1305

280

Acetobacterium woodii

X96954

T TGAAACTCAAAGGAATTGACG AATG CGTTCCCGGGTCTT

90%-

840-1305

 

Beta proteobacteria

    

281

Burkholderia cepacia

U96927

AATACGTTCCCGGGTC TT TTA AAACTCAAAGGAATTGACG

82%-

870-1322

282

Bordetella pertussis

U04950

TTA AAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT

81%-

922-1375

 

Gamma proteobacteria

    

283

Pseudomonas aeruginosa

X06684

AATACGTC CCCGGGCCTT TTA AAACTCAAATGAATTGACG

86%-

923-1384

284

Escherichia coli

X80725

TTA AAACTCAAATGAATTGACG AATACGTTCCCGGGTC TT

83%-

921-1379

285

Klebsiella pneumoniae subsp. pneumoniae

X87276

TT AAAACTCAAATGAATTGACG AATACGTTCCCGGGTC TT

82%-

920-1381

286

Shigella dysenteriae

X96966

TTA AAACTCAAATGAATTGACG AATACGTTCCCGGGTC TT

83%-

908-1362

Multiple alignments of 463 bp sequences of different strains of Bacilli

Dendrogram prepared on the basis of alignment of 463 bp sequence has been given in Figure 2(a&b). Dendrogram prepared for 52 different strains of Bacillus and related genera (taken in our study) and some reference sequences downloaded from NCBI has been shown in Figure 2(a). Dendrogram has been divided in to 7 different groups (I-VII). Group I contains strains belonging to species Bacillus aquimaris and marisflavi. Strains belonging to genera Lysinibacillus (sphaericus and xylanilyticus) and Jeotgalibacillus are present in Group II. Group III contains strains belonging to Genera Terribacillus (sacharrophilus and goriensis), Bacillus subtilis sub sp. spizizinii and Bacillus licheniformis. Group IV contains strains belonging to species, Bacillus mycoides and Bacillus cereus. Group V contains strains belonging to genera Paenibacillus and Brevibacillus and strains belonging to species Bacillus simplex and Bacillus firmus have shared the group VI. Bacillus arsenicus has not shown any grouping with any other species or genera and Bacillus megaterium and Bacillus flexus have shared a single group VII while some strains of Bacillus megaterium, Bacillus flexus and Bacillus aryabhattai have not shown any grouping with any other strain. Second dendrogram (Figure 2b) containing 29 different closely related species has been divided in to two major clusters and only one species Bacillus siamensis GQ281299 has not shown any grouping with any other member. 7 bacterial species i.e. Bacillus aquaemaris AF483625, Bacillus marisflavi AF483624, Bacillus seohaeanensis AY667495, Bacillus vietnamensis AB099708, Bacillus flexus AB021185, Bacillus megaterium D16273, Bacillus koreensis AY667496 lie in one cluster. Other, 21 bacterial strains have shared the other major cluster.
Figure 2

Dendrograms showing the phylogenetic relationship (a) 52 AEFB strains with reference sequences (b) 29 closely related species of genera Bacillus based on 463 bp long 16S rRNA sequences.

Discussion

When we use molecular approaches to study microbial communities then the use of universal primers is not fully successful in finding the clear picture of community. Various researchers have faced such type of problems as Van Elsas et al. (2002) faced the problem when they studied two 16S rDNA clone libraries (one from grassland and one from arable land) prepared with bacterial primers and most of the isolated strains were found to be belonging to phylum Proteobacteria and the number of clones related to Bacilli were very few. When the same microbial communities were studied by Garbeva et al. (2003), by using Bacillus specific primers then a lot of Bacillus clones were isolated. The problem faced by universal primers can be overcome by the use of group specific primers and various researchers have used group specific primers in their studies to overcome this problem. Heuer and Smalla (1997) used Actinomycete specific primers to monitor Actinomycete communities in the potato rhizosphere. Similarly Boon et al. (2001) used several group specific nested PCR systems to identify a lot of groups under same DGGE conditions. So the need of group specific primers is there to find out the diversity and identity of the members of a specific group.

In the present research we have focused on identification and classification of AEFB by using a specific fragment of 16S rRNA gene. So in the following session we have discussed the research related to identification and classification of bacilli by using 16S rRNA gene. As Many researchers have developed a lot of different Bacillus specific primers i.e. Goto et al. (2000), synthesized a Bacillus specific prime pair which was used to amplify a 275 bp sequence near the 5’ end of 16S rDNA gene and this sequence was very specific for identification and classification of Bacillus strains. Garbeva et al. (2003) developed a Bacillus specific primer pair (Bac F and Bac R). Specificity of both primers was checked independently and some species of Bacillus and other related genera have shown 100% similarity with primer Bac F and likewise the reverse primer has shown similarity with 31 different species of Bacillus and related genera. Vardhan et al. (2011) developed a primer pair specific for amplification of a hyper variable region in 16S rDNA gene of Bacillus and related genera.

In the present study we found that a restriction digestion product of 16S rRNA gene (460 bp) by HaeIII enzyme was specific for Bacillus and related genera. Position of this fragment was near the 3’ end of 16S rDNA gene and primer pair specific to this 463 bp fragment has been designed. Primer pair when checked for specificity has shown amplification of a 463 bp long fragment in strains belonging to genera Bacillus, Lysinibacillus, Terribacillus, Brevibacillus and Jeotgalibacillus. No any amplification was seen in two AEFB strains i.e. Bacillus arsenicus and Paenibacillus taiwanensis and 9 different strains of bacterial lineages other than AEFB (Figure 1c&d). Reason for no amplification of this fragment in Bacillus arsenicus and Paenibacillus taiwanensis is may be due to the reason that during the course of evolution these have faced some variations because of which the restriction enzyme sites for Hae III enzymes were deleted at that position and primer pair designed in the present study includes the restriction site which causes the non specificity for primer.

Results of our study indicate that primer pair designed here is specific for Bacillus and related genera and not for other bacterial lineages. Primer pair when checked for homology (in silico) has shown 100% homology with 16S rDNA sequences of 120 species related to genera Bacillus. Bacillus species which do not have shown 100% similarity of these primers have acquired anomalous positions in the classification based on 16S rRNA gene (Yarza et al. 2010). While some species i.e. B. pseudomycoides AF013121, B. ginsengihumi AB245378, B. acidiproducens EF379274, B. endophyticus, AF295302, B. benzoevorans, X60611, B. horneckiae EU86136 have shown anomalous positions with other bacterial lineages according to classification systems based on 16S rRNA gene (Yarza et al. 2010) in spite of having homology with primer pair in our study. Bacilli strains other than the genus Bacillus have also shown the primer pair similarity and these genera are Virgibacillus (7), Geobacillus (5), Filobacillus (1), Jeotgalibacillus (4) and Ureibacillus (5). Almost all the species checked for primer pair homology has shown 100% similarity except Virgibacillus pantothenticus D16275, Virgibacillus proomii and AJ012667. All of these genera belong to the family Bacillaceae except Jeotgalibacillus which belong to the family Planococcaceae. Bacillus related genera which don’t have shown primer pair similarity are Alicyclobacillus (7), Amphibacillus (5), Aneurinibacillus (5), Brevibacillus (16), Gracilibacillus (9) and Paenibacillus (5). Only a few members of these genera have shown homology with primer pair and these are Alicyclobacillus acidocaldarius AJ496806, Alicyclobacillus tolerans Z21979, Brevibacillus invocatus AF378232, Brevibacillus panacihum. Genera which do not have shown primer specificity belong to different species other than Bacillaceae except Amphibacillus, Gracilibacillus and Terribacillus. In our study genera belonging to family Bacillaceae have shown primer specificity and genera belonging to family other than Bacillaceae have not shown primer specificity except some genera which have shown primer specificity in reverse order.

Phylogenetic relationship based on 463 bp sequence of 52 bacilli strains (taken in our study) along with reference sequences (downloaded from NCBI) (Figure 2a) has shown that different bacterial strains belonging to same species and genera have shared a single group except some strains belonging to Bacillus megaterium, B. aryabhattai and B. flexus. As strains belonging to species Bacillus megaterium have not grouped in one cluster. Out of total 8 strains of B. megaterium, only two strains belonging to species B. megaterium have made grouping with B. flexus. Another 6 strains of B. megaterium and two strains of B. aryabhattai have not shown any grouping with any other strain, however all these eight strains lie below B. megaterium and B. flexus group. This shows that different strains of B. megaterium and B. aryabhattai (close relative of B. megaterium) have remarkable strain to strain genetic variations. Grouping of strains belonging to Bacillus related genera in between the strains related to Bacillus indicates that during the course of evolution these genera have been evolved from the older one genera i.e. Bacillus which is similar to the classifications according to others (Xu and Cote 2003; Yarza et al. 2010; Vardhan et al. 2011). Further the phylogenetic relationship of some closely related strains of genera Bacillus, sharing a single cluster in the all species living tree (Yarza et al. 2010) have shown the same phylogenetic relationship in our study (Figure 2b). The only exception is Bacillus siamensis GQ281299 which has not shown any grouping with any other Bacillus species. However, in all species living tree this strain has shown relationship with other Bacillus species which lie in the lower cluster in our study (Figure 2b).

From the present study we can conclude that the restriction digestion of 16S rRNA gene by HaeIII enzyme and amplification of 463 bp fragment with specific primers designed in our study are easy methods for identification of Bacillus and related genera. Further the sequence information and multiple alignment of 463 bp fragment of Bacillus and related genera have been proved to be a good identification and classification tool for Bacillus and related genera.

Declarations

Acknowledgements

Council of Scientific and industrial Research (CSIR), India is acknowledged to provide Senior Research Fellowship to author Sangeeta Kadyan. Authors are also thankful to Department of Science and Technology, New Delhi for providing financial grants under DST-FIST programme and UGC, New Delhi for financial grant under UGC-SAP scheme.

Authors’ Affiliations

(1)
Department of Genetics, M. D. University

References

  1. Ash C, Farrow AE, Wallbanks S, Collins MD: Phylogenetic heterogeneity of the genus Bacillus revealed by comparative analysis of small-subunit-ribosomal RNA sequences. Lett Appl Microbiol 1991, 13: 202-206.View ArticleGoogle Scholar
  2. Ash C, Priest FG, Collins D: Molecular identification of rRNA group 3 bacilli (Ash, Farrow, Wallbanks and Collins) using a PCR probe test. Proposal for the creation of a new genus Paenibacillus . Antonie van Leeuwenhoek 1993, 64: 253-260.View ArticleGoogle Scholar
  3. Boon N, Windt W, Verstraete W, Top EM: Evaluation of nested PCR-DGGE (denaturing gradient gel electropho-resis) with group-specific 16S rRNA primers for the analysis of bacterial communities from different waste water treatment plants. FEMS Microbiol Ecol 2001, 39: 101-112.Google Scholar
  4. Daffonchio D, Borin S, Consolandi A, Mora D, Manachini PL, et al.: 16S–23S rRNA internal transcribed spacers as molecular markers for the species of the 16S rRNA group I of the genus Bacillus . FEMS Microbiol Lett 1998, 163: 229-236.Google Scholar
  5. Daffonchio D, Borin S, Frova G, Manachini PL, Sorlini C: PCR fingerprinting of whole genomes: the spacers between the 16S and 23S rRNA genes and of intergenic tRNA gene regions reveal a different intraspecific genomic variability of Bacillus cereus and Bacillus licheniformis . Int J Syst Bacteriol 1998, 48: 107-116. 10.1099/00207713-48-1-107View ArticleGoogle Scholar
  6. De Clerck E, Van Mol K, Jannes G, Rossau R, de Vos P: Design of a 50 exonuclease-based real-time PCR assay for simultaneous detection of Bacillus licheniformis , members of the ' B. cereus group’ and B. fumarioli in gelatin. Lett Appl Microbiol 2004, 39: 109-115. 10.1111/j.1472-765X.2004.01550.xView ArticleGoogle Scholar
  7. Fortina MG, Pukall R, Schumann P, Mora D, Parini C, et al.: Ureibacillus gen. nov., a new genus to accommodate Bacillus thermosphericus (Anderson et al. 1995) emendation of Ureibacillus thermosphericus and description of Ureibacillus terrreneus sp. nov. Int J Syst Evol Microbiol 2001, 51: 447-455.View ArticleGoogle Scholar
  8. Garbeva P, van Veen JA, van Elsas JD: Predominant Bacillus spp. in Agricultural Soil under Different Management Regimes Detected via PCR-DGGE. Microb Ecol 2003, 45(3):302-316. 10.1007/s00248-002-2034-8View ArticleGoogle Scholar
  9. Goto K, Omura T, Hara Y, Sadaie Y: Application of the partial 16S rDNA sequence as an index for rapid identification of the species in the genus Bacillus . J Gen Appl Microbiol 2000, 46: 1-8. 10.2323/jgam.46.1View ArticleGoogle Scholar
  10. Gurtler V, Stanisich VA: New approaches for typing and identification of bacteria using the 16S–23S rDNA spacer region. Microbiology 1996, 142: 3-16. 10.1099/13500872-142-1-3View ArticleGoogle Scholar
  11. Heuer H, Smalla K: Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) for studying soil microbial com-munities. In Modern Soil Microbiology. Edited by: Van Elsas JD, Trevors JT, Wellington EMH. New York: Marcel Dekker; 1997:353-373.Google Scholar
  12. Heyndrickx M, Lebbe L, Kersters K, Devos P, Forsyth G: Virgibacillus : a new genus to accommodate Bacillus pantothenticus (Proom and Knight 1950). Emended description of Virgibacillus pantothenticus . Int J Syst Bacteriol 1998, 48: 99-106. 10.1099/00207713-48-1-99View ArticleGoogle Scholar
  13. Kadyan S, Panghal M, Kumar S, Singh K, Yadav JP: Assessment of functional and genetic diversity of aerobic endospore forming Bacilli from rhizospheric soil of Phyllanthus amarus L. World J Microbiol Biotechnol 2013. doi:10.1007/s11274-013-1323-3Google Scholar
  14. Kumar P, Khare S, Dubey RC: Diversity of Bacilli from Disease Suppressive Soil and their Role in Plant Growth Promotion and Yield Enhancement. New York Sci J 2012, 5(1):90-111.Google Scholar
  15. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al.: Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23: 2947-2948. 10.1093/bioinformatics/btm404View ArticleGoogle Scholar
  16. Mandic-Mulec I, Prosser JI: Diversity of Endospore-forming Bacteria in Soil: Characterization and Driving Mechanisms. In Endospore-forming Soil Bacteria, Soil Biology 27. Edited by: Logan NA, De Vos P. Berlin Heidelberg: Springer-Verlag; 2011:31-59.View ArticleGoogle Scholar
  17. Nazina TN, Tourova TP, Poltaraus AB, Novikova EV, Grigoryan AA, et al.: Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen. nov. sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus , Bacillus thermocatenulatus , Bacillus thermoleovorans , Bacillus kaustophilus , Bacillus thermoglucosidasius , Bacillus thermodenitrificans to Geobacillus as Geobacillus stearothermophilus , Geobacillus thermocatenulatus , Geobacillus thermoleovorans , Geobacillus kaustophilu , Geobacillus thermoglucosidasius , Geobacillus thermodenitrificans . Int J Syst Evol Microbiol 2001, 51: 433-446.View ArticleGoogle Scholar
  18. Niimura Y, Koh E, Yanagida F, Suzuki KI, Komagata K, et al.: Amphibacillus xylanus gen. nov., a facultatively anaerobic spore foming xylin-digesting bacterium which lacks cytochrome, quinone, and catalase. Int J Syst Bacteriol 1990, 40: 297-301. 10.1099/00207713-40-3-297View ArticleGoogle Scholar
  19. Priest FG, Goodfellow M, Todd C: A numerical classification of the genus Bacillus . J Gen Microbiol 1988, 134: 1847-1882.Google Scholar
  20. Schlesner H, Lawson PA, Collins MD, Weiss N, Wehmeyer U, et al.: Filobacillus milensis gen. nov., a new halophilic spore-forming bacterium with Ornd- Glu-type peptidoglycan. Int J Syst Microbiol 2001, 51: 425-431.View ArticleGoogle Scholar
  21. Shida O, Takagi H, Kadowaki K, Yano H, Komagata K: Proposal for two new genera, Brevibacillus gen. Nov. and Aneurinibacillus gen. nov. Int J Syst Bacteriol 1996, 46: 939-946. 10.1099/00207713-46-4-939View ArticleGoogle Scholar
  22. Stackebrandt E, Swiderski J: From phylogeny to systematics: The dissection of the genus Bacillus . In Applications and systematics of Bacillus and relatives. Edited by: Berkeley R, Heyndrickx M, Logan N, De Vos P. Malden: Blackwell; 2002:822.Google Scholar
  23. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance and Maximum Parsimony Method. Mol Biol Evol 2011, 28: 2731-2739. 10.1093/molbev/msr121View ArticleGoogle Scholar
  24. Van Elsas JD, Garbeva P, Salles J: Effects of agricultural measures on the microbial diversity of soil as related to suppression of soil-borne plant pathogens. Biodegradation 2002, 13: 29-40. 10.1023/A:1016393915414View ArticleGoogle Scholar
  25. Vardhan S, Kaushik R, Saxena AK, Arora DK: Restriction analysis and partial sequencing of the 16S rRNA gene as index for rapid identification of Bacillus species. Antonie Van Leeuwenhoek 2011, 99: 283-296. 10.1007/s10482-010-9487-4View ArticleGoogle Scholar
  26. Waino M, Tindall BJ, Schumann P, Ingvorsen K: Gracillbacillus gen. nov., with description of Graclibacillus holotolerence gen. nov., and Bacillus salexigens to the genus Salibacillus gen. nov., as Salibacillus salexigens comb. Nov. Int J syst bacteriol 1999, 49: 821-831. 10.1099/00207713-49-2-821View ArticleGoogle Scholar
  27. Wisotzkey JD, Jurtshuk P Jr, Fox GE, Deinhard G, Poralla K: Comparative sequence analyses on the 16S r RNA (rDNA) of Bacillus acidocaldarius , Bacillus acidoterrestris , and Bacillus cycloheptanicus and proposal for certain of a new genus, Alicyclobacillus gen. nov. Int J Syst Bacteriol 1992, 42: 263-269. 10.1099/00207713-42-2-263View ArticleGoogle Scholar
  28. Xu D, Cote JC: Phylogenetic relationships between Bacillus species and related genera inferred from comparison of 3’ end 16S rDNA and 5’ end 16S–23S ITS nucleotide sequences. Int J Syst Evol Microbiol 2003, 53: 695-704. 10.1099/ijs.0.02346-0View ArticleGoogle Scholar
  29. Yarza PW, Ludwig J, Euzeby R, Amann KH, Schleifer FO, et al.: Update of the All-Species Living Tree Project based on 16S and 23S rRNA sequence analyses. Syst Appl Microbiol 2010, 33: 291-299. 10.1016/j.syapm.2010.08.001View ArticleGoogle Scholar
  30. Yoon JH, Weiss N, Lee KC, Lee IS, Kang KH, et al.: Jeotgalibacillus alimentarius gen. nov., sp. Nov., a novel bacterium isolated from jeotgal with L-lysine in the cell wall, reclassification of Bacillus marinus (Ruger 1983) as Marinibacillus marinus gen. nov., comb. Nov. Int J Syst Evol Microbiol 2001, 51: 2087-2093. 10.1099/00207713-51-6-2087View ArticleGoogle Scholar

Copyright

© Kadyan et al.; licensee Springer. 2013

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.