Skip to main content

Advertisement

Table 1 The primer sequences for qRT-PCR

From: Correlations of microRNA-124a and microRNA-30d with clinicopathological features of breast cancer patients with type 2 diabetes mellitus

Gene Forward (5′-3′) Reverse (5′-3′)
U6 GCTTCGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT
miR-124a UUAAGGCACGCGGUGAAUGCCA CTTAAGGCACGCGGTGAATGCCA
miR-30d UGUAAACAUCCCCGACUGGAAG TGTAAACATCCCCGACTGGAAGA
  1. qRT-PCR quantitative real-time polymerase chain reaction