Skip to main content

Table 1 Information of primers pairs and sizes of the PCR products

From: Molecular diagnostic markers of Tachysurus fulvidraco and Leiocassis longirostris and their hybrids

Locus Primer sequences (5′–3′) PCR products sizes (bp)
T. fulvidraco F TL L. Longirostris F LT
COI F: CTACAATCCACCGCCTAA
R: TAGAAGAAAGTGACAGAGCG
1515 1515 1515 1515
ITS F: GTAGGTGAACCTGCGGAAGGATCA
R: GAGTTTACCACCCGCTTTGGGCTGCATT
1106 1018
ITSP F: CGTAACAAGGTTTCCGTAGGTG
R: ATCCACCGCTAAGAGTTGTCAG
678 602 and 678 602 602 and 678