Skip to main content

Table 1 Information of primers pairs and sizes of the PCR products

From: Molecular diagnostic markers of Tachysurus fulvidraco and Leiocassis longirostris and their hybrids

Locus

Primer sequences (5′–3′)

PCR products sizes (bp)

T. fulvidraco

F TL

L. Longirostris

F LT

COI

F: CTACAATCCACCGCCTAA

R: TAGAAGAAAGTGACAGAGCG

1515

1515

1515

1515

ITS

F: GTAGGTGAACCTGCGGAAGGATCA

R: GAGTTTACCACCCGCTTTGGGCTGCATT

1106

1018

ITSP

F: CGTAACAAGGTTTCCGTAGGTG

R: ATCCACCGCTAAGAGTTGTCAG

678

602 and 678

602

602 and 678