Skip to main content

Advertisement

Table 1 Information of primers pairs and sizes of the PCR products

From: Molecular diagnostic markers of Tachysurus fulvidraco and Leiocassis longirostris and their hybrids

Locus Primer sequences (5′–3′) PCR products sizes (bp)
T. fulvidraco F TL L. Longirostris F LT
COI F: CTACAATCCACCGCCTAA R: TAGAAGAAAGTGACAGAGCG 1515 1515 1515 1515
ITS F: GTAGGTGAACCTGCGGAAGGATCA R: GAGTTTACCACCCGCTTTGGGCTGCATT 1106 1018
ITSP F: CGTAACAAGGTTTCCGTAGGTG R: ATCCACCGCTAAGAGTTGTCAG 678 602 and 678 602 602 and 678