Skip to main content

Advertisement

Table 1 List of primers for RT-PCR

From: The effects for PM2.5 exposure on non-small-cell lung cancer induced motility and proliferation

Gene Forward Reverse
TNFRSF1A GGTCTCAACGCCATCCTG GCTCCATTTATCAGAACATCTCC
TP53 ATGGCACTGAGGAAGATGCT CAGATAATGCGGGAAAGAGG
EREG ATGCCCGATGAGATCAACA CGACAGGTTTCCCACATGAC
IL1A GTGGGCTGTGCCAAGTGT GGTCACGGTCAGGGTTGTA
IL1B GAACTCCTGCTTCTCCTTGC ACTTGGCACAGCCCACAG
MMP1 GCCTCTGATTGGTGAATGGT TCTTGTCCCTCTGGTCCTGT
MT1X TGGCAGAAAGGGAACAGAAA CTGGCTGATGGACAGGAGAT
GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC