Skip to main content

Advertisement

Table 5 Nucleotide sequence of primers used in the PCR assay

From: Molecular characterization and phylogenetic analysis of dengue virus type 1 in Guangdong in 2014

Name Forward primer sequence (5′ → 3′) Position Name Reverse primer sequence (5′ → 3′) Position
1F GTTAGTCTACGTGGACCGAC 6–25 1R CCAACACCACATCTACCCAA 992–1011
2F TAGCACATGCCATAGGAACATC 856–887 2R CCTTCGTATTTAACCTGCACTAG 1896–1918
3F TCACAAGAAGGAGCAATGCACA 1698–1719 3R AAGAAGAACTTCTCTGGATGTTA 3763–3785
4F TGGAGCCAACGCTTCCGACA 3651–3675 4R TCCCAGGAGACCTCAGCCGC 4296–4315
5F ATATCTGGAAGCTCAGCCGA 4260–4279 5R CCCTGGTTCAACAGCAATCA 4810–4829
6F CTGTACTCATGTATCAAGGGAAGA 4687–4710 6R CTTGGATAACTGCGTTGCTCTG 5502–5523
7F AGGGAATGCCAATAAGGTAC 5230–5249 7R GTCCTGCTAAGATGACACGC 5840–5859
8F CAGAGCAACGCAGTTATCCA 5502–5521 8R CAATTTAGCGGTTCCTCTCG 7741–7760
9F GCAAGTCAGAATTCAACACC 7636–7655 9R CATATGATCCATGATAGGCC 8480–8499
10F CGATTCACAATGGCTCACAGGA 8295–8316 10R ATGGCACCACTATTTCCCTCCC 9732–9753
11F CTAACCTACCAAAATAAAGT 9383–9301 11R TTAGTCTTCTCACTTGGTTT 10,172–10,191
12F CCATATTTAGGGAAAAGGGA 10,080–10,099 12R CGCCTGGAATGATGCTGTAG 10,672–10,691
E 1F TAGCACATGCCATAGGAA 856–873 E 1R CTGGGTCTCAGCCACTTC 1866–1883
E 2F ATGCAAAGAAGCAGGAAG 1666–1683 E 2R AATTTGTATTGCTCTGTCCA 2502–2521
E 3F CATAGGAACATCCATCACC 866–884 E 3R TATTGCTCTGTCCAAGTGTG 2496–2515
E 4F GAACATCCATCACCCAGAAA 871–890 E 4R GCTCTGTCCAAGTGTGAACTT 2491–2511