Skip to main content

Advertisement

Table 1 Primer sequences used for studied genes mRNA expression assay

From: Features of omental adipose tissue in endometrial cancer patients with ‘standard’ or ‘metabolically healthy’ obesity: associations with tumor process characteristics

Primer 5′-3′ sequence Fragment size in base pairs
UCP1-ex3/4_F GTCTTTGGAAAGGGACTACT 125
UCP1-ex5/6_R GGGGACGTCATCTGCTAATA
UCP1-P FAM-AGTGTCATCATCAATTGTACAGAGCT-BHQ
CYP19A1 ex3/4-F TTATCAGCAAGTCCTCAAGTAT 179
CYP19A1 ex4/5-R GGGGCCTGACAGAGCTTTC
CYP19A1 ex4-P FAM-AGGCATCATATTTAACAACAATCCAGA-BHQ
Omentin-F AACAGCTCCCTGCTGAGGTA 199
Omentin-R GCTGGCCATAGGGTGAGTAA
Omentin-P FAM-CATCTACCAGAAATATCCAGTGAAAT-BHQ
PTEN ex 5/6-F GAGACAAAAAGGGAGTAACTAT 155
PTEN ex 6/7-R ATTGCAAGTTCCGCCACTGA
PTEN ex6-P FAM-TATAGCTACCTGTTAAAGAATCATCTG-BHQ
SDHA-F CCACTCGCTATTGCACACC 102
SDHA-R CACTCCCCGTTCTCCATCA
SDHA-P JOE-ACGGTCTCTGCGATATGATACCA-BHQ
  1. UCP1 uncoupling protein one, CYP19A1 cytochrome 19, aromatase, PTEN phosphatase and tension homolog, SDHA succinate dehydrogenase catalytic subunit