Skip to main content

Advertisement

Table 3 List of differentially expressed genes

From: A new gene regulatory network model based on BP algorithm for interrogating differentially expressed genes of Sea Urchin

ID ORF SEQUENCE
1776 APOBEC ATAAGAACCAGTGGGGCCCACCCAGTTTCACCCTCCTCTCTCAT
5123 Otp ACCCGCATCGCAATCTCCTCCCGCATGAAGATATCAGGATAGT
2789 Gsk-3 GTCCTAGGAACCCCAAGCCGTGACCAGATCAAGGAGATGAAC
1078 Nk1 GCCATCATCACCCGACCCAACTGCAGCAGCTATTCATACAT
6021 gataC TAGTTCAGCACCTCATCCCGGTCCAACAAGTTCCTACACGTTACC
3972 FoxG TCATGATGGCTATTCGCTCGAGTCCAGAGAAAAGACTAACTCTAAATG
4071 G-cadherin GTGCGAGGAGACCAGCCTTTCCATCGAGTTCATCACAGAGACTC
5397 Blimp1-Krox ACCTATGTATGGCCTGTCACCAAACTACATCAGTACTGCAGGTGGT
3498 FoxO CGATCATGACCACACATCCAGAAATCGACATGCATGACAATGAAGTC
265 APOBEC ACAACAGCTCCTCCCCTCACCCCTACCAGTCAGGCTACCACC
2208 SM30-E TCAACCTGGTTTTGGACAACCCGGTGTTGGTCAACCCAATAGA
5073 otx GCACTTTCTGATCTTGCTAGTCGTGAAATCAAGATGGAATCACATTCT
1987 P16 AAGTGATGACGACGGCAGCAGCGATGATGACGGTAGCAGTGAT