Skip to main content

Advertisement

Table 4 Tandem repeat sequences in the S. purpurea mt genome

From: Assembly and analysis of the complete Salix purpurea L. (Salicaceae) mitochondrial genome sequence

No. Size (bp) Location Repeat
1 14 IGS(nad5, trnV-GAC) TTTAAGAATACCGA (×2)
2 13 IGS(trnV-GAC,cox1) TTAGTTTATGAAT (×2)
3 15 IGS(trnM-CAT, ccmFc) ATTATAGGATTATATT (×2.1)
4 21 IGS(ccmFc, trnS-GGA) TATTATAAGATCATCTCACCT (×2)
5 19 IGS(ccmFc, trnS-GGA) TTTTCTTCTTGCTTCTGTT (×2.1)
6 20 IGS(atp8, nad5) AGAGTATGAAAGAACAGAAT (×2)
7 13 IGS(atp8, nad5) AAGAATGAATTAC (×2.2)
8 15 nad1 TAAAAAAAAAAAGGC (×2)
9 28 IGS(rps4, trnP-TGG) TATAAAGAAAGACCTTGTACATCTGTCC (×2.1)
10 22 IGS(trnP-TGG, rpl10) TTTCTTCCCTCTCTATAGCCTA (×2)
11 4 IGS(atp1,trnH-GTG) CTTT (×6.5)
12 25 IGS(atp1,trnH-GTG) TCGACTGTTAAGGACACAGAGGGGA (×1.9)
13 22 IGS(atp1,trnH-GTG) TTCGTGTACCAATTTCAGTGGT (×2)
14 14 IGS(trnN-GTT, trnY-GTA) TTAGGTAGGATAGA (×2.1)
15 7 nad2 (intron) CTTATAT (×4)
16 18 nad2 (intron) AACATTATAAGAAAAGAT(×2.1)
17 24 IGS(rpl16,trnP-TGG) CATAACCAGGCAGTGAGGAATCTT (×2)
18 13 IGS(trnG-GCC,cox2) AATAAGAATAATA (×2.8)