Skip to main content

Table 2 Respective sequences of nine microsatellite loci of T. maxima developed by Grulois et al. (2014) using in our study

From: Genetic diversity and population differentiation of small giant clam Tridacna maxima in Comoros islands assessed by microsatellite markers

Locus Primer sequence 5′-3′ Size
Tm06526 F: TCCCATTGAAAAGTCTACGCAC
R: GCTGCAGAAATTTGTTCGACATC
263–295
Tm11666 F: ATCGCACTTCCGCTTTGATG
R: ATTTATCGTGAACCCTATATCGC
217–253
Tm14538 F: AGCCTAGAGAGAAATACAGAAAGG
R: GTCTCACCGAACTAGATCCCC
88–120
Tm20025 F: GCGCGAGAAATCTAAGGCAC
R: ACATCTGTAGAAAGTCTTGTTATCATC
240–282
Tm23637 F: GTCCTTGGGCAGGAGATTTTG
R: ACTCTGAGGGTGTTGATTGAC
199–243
Tm23670 F: GGTCGGTAGAGAAGGTGTCC
R: CCGCCTTCAAATCCATCCAC
143–217
Tm24162 F: TGGACAGATTCAGTGTCGGC
R: GACCGGTTTGAATGGAGCTG
193–260
Tm24224 F: TGTATGCCGTCCACAAAAGC
R: TTCGAAGAAAGTCCACACCG
258–292
Tm25349 F: TCCGTTTCCTATTGATGTTGTCC
R: CATCTCTGGCGGCAGTTTG
105–133