Skip to main content

Advertisement

Table 2 Probe sequences for microarray

From: Genotyping and detection of common avian and human origin-influenza viruses using a portable chemiluminescence imaging microarray

Probe Sequence (5′–3′)b Target Gene Location Referencea
H7-a ACTGGACCACCCCAATGTGACCAATTCCTAGAATTT H7N9 HA 235–270 CY146908
H7-b ATAGGACCTCCCCAATGCGATCAATTTCTGGAGTTT H7N9 HA 235–270 CY146908
N9 GGAAACACTCAAACGGAACAATACACGATAGGTCCCAGTA H7N9 NA 413–452 CY146910
PH1N1 GGCTCGAATCGACCGTGGGT PH1N1 NA 912–931 CY081570
H1N1 CAATCCAGTGACTGTTGATGGAGCAA H1N1 NA 1025–1050 AJ006954
H3N2 TAACATTACAGGATTTGCACCTTTTTC H3N2 NA 295–321 CY091836
H5N1-a CAAATAGGCCATGGGTATCTTTCAATC H5N1 NA 856–882 AM183680
H5N1-b GTGTCCCCTAACGGGGCATATGGGG H5N1 NA 972–996 AM183680
A CTCATGGAATGGCTAAAGACAAGACCAA Influenza A M 149–176 HQ664927
B AATGAAGGACATTCAAAGCCAATTCGAGCAGCTGAAACTGCG Influenza B NS 775–816 CY099917
RP-P TTCTGACCTGAAGGCTCTGCGCGCG Human RNase P 71–95 NM_006413
RP-P1 CATGAACCCAGGAGGCGGAGCTTGC Human RNase P 1995–2019 NM_006413
PR-P4 ACATGCATTTATGCAATATTAATGT Human RNase P 1859–1883 NM_006413
(T)20 TTTTTTTTTTTTTTTTTTTT Quality controlc    
  1. aThe numbers are NCBI accession codes
  2. bA repeat sequence of (T)12 with an amino-labeled 3′-end was connected to the 3′-end of all the probes
  3. cA repeat sequence of (T)20 with an amino-labeled 3′-end and biotin-labeled 5′-end was used for quality control during microarray