Skip to main content

Advertisement

Table 1 Primer sequences for microarray

From: Genotyping and detection of common avian and human origin-influenza viruses using a portable chemiluminescence imaging microarray

Primer Sequence (5′–3′) Target Gene Location Referencea
NA-1Sa GTTCTATGCTCTCAGCCAAGG H7N9 NA 378–398 CY146910
NA9r-B-4 GCATTGTTGTTTGGTCCTGATATAC H7N9 NA 569–593 CY146910
H7F1 AGACCTCGGTCAATGYGG H7N9 HA 201–218 CY146908
H7R2-B TTCACGAATTTCCCAGGATAACA H7N9 HA 313–335 CY146908
NF11 CAAGAGTCTGAATGTGCATG H5N1 NA 699–718 AM183680
NR22B GGATCCCAAATCATTTCAAA H5N1 NA 1134–1153 AM183680
F7 GTGTGTGCAGGGATAACTGG PH1N1 NA 889–908 CY081570
R4aB ATTAGGGCGTGGATTGTCTC PH1N1 NA 988–1007 CY081570
NF12 CAAGAGTCTGAATGTGTCTG H1N1 NA 699–718 AJ006954
NR21B GGATCCCAAATCATCTCAAA H1N1 NA 1131–1150 AJ006954
NF5 CTGACCAACACCACCATA H3N2 NA 221–238 CY091836
NR5B CATCAATAGGGTCCGATA H3N2 NA 482–499 CY091836
MF2 GGCCCCCTCAAAGCCGAGAT Influenza A M 77–96 HQ664927
MR2B CAAAGCGTCTACGCTGCAGT Influenza A M 244–263 HQ664927
FBF1 ATGGCCATCGGATCCTCAACTCACTC Influenza B NS 737–762 CY099917
FBR1B TCATGTCAGCTATTATGGAGCTGTT Influenza B NS 956–980 CY099917
RP-F4 TGGGATCATGTTAAGTAGAAGTAGC Human RNase P 1821–1854 NM_006413
RP-R4B CTCCATTGTTTTAGAGCCCTTAC Human RNase P 1882–1904 NM_006413
RP-F1 TGCGGGTTGGAGAAAATACA Human RNase P 1964–1983 NM_006413
RP-R1B GGAGGCTGAGGCAGGAGAAT Human RNase P 2086–2105 NM_006413
RP-F AGATTTGGACCTGCGAGCG Human RNase P 50–68 NM_006413
RP-RB GAGCGGCTGTCTCCACAAGT Human RNase P 95–114 NM_006413
  1. aThe numbers are NCBI accession codes