Skip to main content

Advertisement

Table 1 Primers/probe for detection of DENV and serotype-specific primers for amplification of E gene

From: Epidemiological and molecular characterization of dengue viruses imported into Guangzhou during 2009–2013

Primers/probe Sequences (5′–3′)
DENf GCATATTGACGCTGGGARAGAC
DENr GCGTTCTGTGCCTGGAWTGATG
DENp FAM−CA+GAGA+TCC+TGC+TGTCTC−BHQ1
Den1-Ef ATGCGATGCGTGGGAATAGG
Den1-Er CGCCTGAACCATGACTCCTAGG
Den2-Ef GCCTGCAGCTTCAATGACAATGCGTTG
Den2-Er GCTCTAGACGGCCTGCACCATAAC
Den3-Ef TGGGTTGACGTGGTGCTTGAGCACGG
Den3-Er ATGGCTGTTGCCAATCTTTTTGGGGA
Den4-Ef TCCAGCGAACTGTCTTCTTTGT
Den4-Er AACCCGTGTCTGCTTGAACTGTG