Skip to main content

Table 1 The primers, strains and plasmids used in this study

From: Multidrug resistance operon emrAB contributes for chromate and ampicillin co-resistance in a Staphylococcus strain isolated from refinery polluted river bank

Primers, strains and plasmids

Sequence (5′–3′) or description

Source or reference

Primers for qPCR (Supplied in Additional file 1: Table S1)

 Primers for gene knockout (Extended sequences for overlap are marked with underline)

  EmrB-up-F

TTAACTAGACAGATCTATTTCTATTTTGGCTTGTCGTT

This study

  EmrB-up-R

AAAATCCCTTAACGTGAGTTCCTTTTGTTGGCGTTTGC

This study

  EmrB-down-F

CCGAAAAGTGCCACCTGAAATATGGTGGTCAAGAAGGCG

This study

  EmrB-down-R

GGGCGATATCGGATCCCTGGATACAGCATGTGGAAAC

This study

  EmrA-up-F

TCGATGCATGCCATGGAAATGTCAGCAACTTCTTCAGG

This study

  EmrA-up-R

AAAATCCCTTAACGTGAGTTAATAAAAGCCAGCAATCCCAAT

This study

  EmrA-down-F

CCGAAAAGTGCCACCTGAAATCCTGGAATGAACGCTGAAG

This study

  EmrA-down-R

GGGCGATATCGGATCCAAATAGATACGCCGTAATTGGTA

This study

  npt II-F

AACTCACGTTAAGGGATTTTGG

This study

  npt II-R

TTTCAGGTGGCACTTTTCG

This study

 Strains used in this study

  S. aureus LZ-01

S. aureus LZ-01 is the isolated objective strain

Zhang et al. (2013)

  S. aureus ATCC 25923

S. aureus ATCC 25923 is a purchased standard strain

Purchased from CCTCC

  S. aureus RN4220

Initial recipient for modification of reconstructed plasmids

Augustin and Götz (1990)

  E.coli. Top 10

E.coli. Top10 is used as a host for vector replication

University of Chicago

  ΔemrB

ΔEmrB is S. aureus LZ-01 mutant strain with deletion of emrB

This study

  ΔemrA

ΔEmrA is S. aureus LZ-01 mutant strain with deletion of emrA

This study

  CB

S. aureus CB is the complemented strain for ΔemrB

This study

  CA

S. aureus CA is the complemented strain for ΔemrA

This study

 Plasmids

  pMAD

pMAD is a shuttle vector used for gene knockout of S. aureus

Arnaud et al. (2004)

  pET-30a

pET-30a used for clone of npt II gene

Purchased