Skip to main content

Table 8 Amplification and extension primers used for genotyping TLR4 gene

From: Genetic association of Toll-like receptor 4 gene and coronary artery disease in a Chinese Han population

SNPs Forward primers Reverse primers Extension primers
rs11536889 ACGTTGGATGTTTCCTGTTGGGCAATGCTC ACGTTGGATGACCCCATTAATTCCAGACAC TTTTTTCTCAATGATAACATCCACTC
rs1927907 ACGTTGGATGTAAGGTAGACCACCTCTCCC ACGTTGGATGGGTATCCAGTGGATTGAAGA GGAATTACATAAGAGACATTGTTTGA
rs1927911 ACGTTGGATGCATCACTTTGCTCAAGGGTC ACGTTGGATGCAGACCTTCCTTAGTCATGG AGAGTTTGACAACTGCATTCTTTTC