Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Summary of quantitative real-time PCR primers used in this study

From: Water temperature induces jaw deformity and bone morphogenetic proteins (BMPs) gene expression in golden pompano Trachinotus ovatus larvae

Primers Sequence (5′–3′) Amplicon sizes (bp)
BMP2-qF CAGGCAGCACTCCGCAAAC  
BMP2-qR TCCCCGTGGCAGTAAAAGG 146
BMP4-qF GTGAACAACAACATTCCCAAGG  
BMP4-qR GCAGCCCTCCACTACCATTT 126
BMP5-qF GTGGAGACTGTAGACGGACGAA  
BMP5-qR TGAAGAAAGCAACCAGGAAGG 100
BMP10-qF CCGCTTCAGTCTTCTCCAACC  
BMP10-qR CGGATTATCACCCACATCCCTA 149
EF-1α-qF CCCCTTGGTCGTTTTGCC  
EF-1α-qR GCCTTGGTTGTCTTTCCGCTA 101
  1. Note for BMP names: qF forward primer for real-time PCR, qR reverse primer for real time PCR