Skip to main content

Advertisement

Table 1 Summary of genes cloning primers used in this study

From: Water temperature induces jaw deformity and bone morphogenetic proteins (BMPs) gene expression in golden pompano Trachinotus ovatus larvae

Primers Sequence (5′–3′) Amplicon sizes (bp)
BMP2-F CGTGCTGACCAAGACCTAAC  
BMP2-R AACCGGGTGTCCATAATAAC 1549
BMP4-F GACACCTTCCCTTTCACAT  
BMP4-R CAAGTCCAAGTTCTAGTTAGTTT 1425
BMP5-F CCAACGAAGACACTACAAGG  
BMP5-R TTAAAGTTAGCCCAGCCACT 871
BMP10-F GAAGGACAGTCCTCCCTCAA  
BMP10-R TGCAGCATTGCTTTGCTTTA 1854
EF-1α-F TGTTACCTGGCTAGGGG  
EF-1α-R GAGAAGAGGCACCGTCA 1662
  1. Note for BMP names: F forward primer, R reverse primer