Skip to main content

Advertisement

Table 2 Primers used for amplifying segments of the mtDNA rns gene

From: The diversity of mtDNA rns introns among strains of Ophiostoma piliferum, Ophiostoma pluriannulatum and related species

Primer name Sequence (5′–3′)
rns-F0 GAGTTTGGTGATGGCTCTG
rns-F1 GCTGCCAGCAGTCGCGG
rns-F2 GGATTAGAGACCCTTGTAG
rns-F3 ACACCAGTAGTGAAGTATG
rns-R0 CCACTACACGAACCGTATTTC
rns-gp2-R1 CATTAACTGGAAACAGCCGTGCAAC
rns-R2 CTACAAGGGTCTCTAATCC
rns-R3 CCGCGACTGCTGGCACG
mtsr-1 AGTGGTGTACAGGTGAG
mtsr-2 CGAGTGGTTAGTACCAATCC