Skip to main content

Advertisement

Table 2 33 SSR markers selected from 15 linkage groups of tea plant

From: An efficient identification strategy of clonal tea cultivars using long-core motif SSR markers

Linkage Primer Motif Forward (5′ → 3′) Reverse (5′ → 3′) Tm (°C) Dye
LG01 TM447 (AAAAG)5 TGTTGTTAACGGTGTTCGGA GCATTTGTTTTCTCTCTCTGCC 52 TAMRA
LG02 TM514 (TCA)5 ATGTCTGGCCGTGGATTAAG ATGGCAGGCTGTTCTGATTT 52 FAM
LG02 TM480 (GTA)5 CGAAGAGTCGTTTCGAGGAG CATCCCTTGTCTTCTCCCCT 52 FAM
LG03 TM337 (CCAATT)6 GTGCGGCAAAGCTGTCTT ACCTCCATCTCCAAACCC 60 FAM
LG03 TM453 (TTC)6 AAGTCACAACACCACCACCA GAGGCAGCGATAGTACCAGG 52 TAMRA
LG04 TM343 (TGTTGA)3 ATCTTGGTAAGCTGCTCT ATCATTGCTTTTGTTCTG 56 FAM
LG04 TM445 (GTA)5 CCCAAATCCCAAGCTGTAGA ACGATCGAGCCTGCAATACT 52 TAMRA
LG04 TM502 (AGAT)4 TGTCTTTTGTGGTTTCGTGC GGGAGACGATGGATCAGAAA 50 FAM
LG04 TM422 (TTC)7 GGACTTCGTTGCTTCCTTTG CCATTCTCGACGAATCCAGT 52 TAMRA
LG04 TM369 (GAA)8 CGGAGCTGGAATCTGAAGAG GGAAGGGTTGCAAATTCTGA 52 FAM
LG04 TM523 (AAAAGA)3 TTTGCATTTTTGCCAAGTGA CTTGCGTGACAATGCTCATAA 52 FAM
LG05 TM589 (CTCCT)3 CACCACTGCCCAACAAACT GAGGATGATGATTCGGGAGA 52 TAMRA
LG05 TM428 (CAC)7 TCTCCTCCTCGATCCTCAGA CCCTCTTCTTCGGATCCTTC 52 FAM
LG06 TM341 (TCGAA)5 CGTACTTCAACGCTATAGCTCTCT CTTCGGCATGGCTTCTAAAC 52 FAM
LG07 TM415 (CCTTC)3 TCCACCCAAAACCTACTCTCTC TATTTCGGAAACGAGCCATC 52 TAMRA
LG07 TM426 (AGA)11 TGAGAGTGCTTGTCTGGGTG CAACTACCCCTTTTCCCCAT 52 FAM
LG07 a TM324 (TTTTTG)5 CATCGTTTCATTGCTTATT ATTTTCGGCATTGTCTT 54 FAM
LG08 TM352 (GAGGTG)4 CTTCTTCCTGTCGGGTTGAG GTCAACGGCCTATAACGGAA 52 TAMRA
LG08 TM395 (TCTTTT)4 GATTGTAGGACAGCCGTGGT AAGTTGGGGCTTGTTAAAGGA 52 FAM
LG08 TM493 (AGG)6 GATAGGGACAGAGATCGGCA TTTCCAACCTTGCTCAAACC 52 FAM
LG09 a TM442 (ATACAC)3 CAAGCCAAACCTTGCTGAAT CTGTCCTGTGTCTGGTGGTG 52 FAM
LG09 TM440 (TTTGC)3 TTGACCCGAATAAAATGGGA CCTCAAAACATGCTTTTCTTAATC 52 FAM
LG10 TM407 (CAAGAT)3 AACAACAGCAGCGAAGATGA CCACCACTGATGACCCTTTT 52 TAMRA
LG10 a TM569 (GTGA)5 GCAAATTCGTAAGGCGAGAG CTGACGTTTACCCTCGTTCC 52 FAM
LG11 a TM461 (ATTTTT)6 GGCTAGGGTTTCTCCCACTT GAAGGTCGAAGCGATGTTGT 52 TAMRA
LG11 a TM581 (AAAAAC)3 AAGGATCACTGGTAAAAAGCCA CTTCTGAGCCGTTCTTGAGC 52 FAM
LG12 TM241 (GAGAA)3 ATCGGCGACGGTGGAAGT GCCAGCGGAGAGGAGAAG 58 FAM
LG12 TM499 (AGA)5 AACTGTGACACCGATTGCAG AAGTTTCACTTGCCAGCACC 54 FAM
LG13 TM425 (TTATT)3 CACGTTCGCATATTTTGGTG TTGCTGACGACAACATTTTATT 52 FAM
LG13 TM576 (TTTTC)3 CGCTCTTCCTTGTTTTCTGG CACAAGCCATTGTAGAGAGAGAAA 52 FAM
LG14 TM348 (TATC)7 GAGATGGCTTGCTCAAGGTC CCCCAACCAAATCAAATCAC 52 FAM
LG14 a TM351 (GGAGAA)3 GGGTGAGAGTAAAGGGGGAG AAACACAAAATCAAATTTGTCAGAA 52 FAM
LG15 TM601 (GGA)5 TTGCACTGGAGTGCGATAAG CATCGCCACCAAACTCTTCT 52 FAM
  1. aSelected as core SSR markers to fingerprint 66 clonal tea cultivars