Skip to main content

Advertisement

Table 1 Primer sequences of the four poplar DELLA genes

From: Molecular cloning, expression analysis and subcellular localization of four DELLA genes from hybrid poplar

Primer_ID Forward PCR primer (5′–3′) Reverse PCR primer (5′–3′)
PeRGA1_3OUTER CATCAAGAAACCATTGGTGGTGCT TACCGTCGTTCCACTAGTGATTT
PeRGA1_3INNER CAAAGCTGAATCTTCTTCTTCGTCAAT CGCGGATCCTCCACTAGTGATTTCACTATAGG
PeRGA1_5OUTER CATGGCTACATGCTGACAGCCTA CCCAACTAGGGTGAGCTTCATTCG
PeRGA1_5INNER CGCGGATCCACAGCCTACTGATGATCAGTCGATG ATCGAATTCTTGTTGAGGATAGGCAGC
PeRGA1_ORF ATGAAGAGAGATCATCAAGA TCATTGACTCGGTAGCTCGA
PeRGA1_sRT-PCR AAGCTTGTTTGACTCACTC ACGTTTCATGTCGCT
PeRGA1_qRT-PCR GTTGGGTTCAAAGCATG GGGAATTGCTCTGAGAT
PeRGA2_3OUTER CACTATAACCCTTCAGATCTCT TACCGTCGTTCCACTAGTGATTT
PeRGA2_3INNER TCAACAATCTACCTTCTACTGATCTTGA CGCGGATCCTCCACTAGTGATTTCACTATAGG
PeRGA2_5OUTER CATGGCTACATGCTGACAGCCTA ATTGCATTCCCTGTTTTAAACC
PeRGA2_5INNER CGCGGATCCACAGCCTACTGATGATCAGTCGATG CTCGACTTGCATTCGCGAAAGCTTCAAG
PeRGA2_ORF ATGAAGAGAGATCATCAAGAA TCATTGTTGTGAATCACCAG
PeRGA2_sRT-PCR ACTGATCTTGATTCATCTA TGCCGGCGCAATATTAGACC
PeRGA2_qRT-PCR CTTAGATTTCCCCAGTAA CTAGAAAAACCGGACCGT
PeGAI1_3OUTER CTTACTAGCACCGGTACTATGAC TACCGTCGTTCCACTAGTGATTT
PeGAI1_3INNER TGGATGAACTTTTAGCTGTTTTGGGTTA CGCGGATCCTCCACTAGTGATTTCACTATAGG
PeGAI1_5OUTER CATGGCTACATGCTGACAGCCTA ACTCACTGATCCCTCCAACGAG
PeGAI1_5INNER CGCGGATCCACAGCCTACTGATGATCAGTCGATG CTCCGGTTTCATTTGTTTCACAACTGAT
PeGAI1_ORF ATGAAAAGAGAACACTCAA TTAAGCAGCACCGCCTACTGG
PeGAI1_sRT-PCR GAGATTGTTACTGTCGTTG CACTGAGTCAGGGTC
PeGAI1_qRT-PCR GTCAAACAAATCGGCTT AATATCTGAGAGAGAGT
PeGAI2_3OUTER TAAGATCGTCAGACATGGCTGA TACCGTCGTTCCACTAGTGATTT
PeGAI2_3INNER CACGCGCAAGAAGATGGTCTTTCCCAC CGCGGATCCTCCACTAGTGATTTCACTATAGG
PeGAI2_5OUTER CATGGCTACATGCTGACAGCCTA CTTCCCCAAGTACACCTCTGAC
PeGAI2_5INNER CGCGGATCCACAGCCTACTGATGATCAGTCGATG ATTATGGTTCGCTTCTTGCTCAACAACA
PeGAI2_ORF ATGAAAAGAGAACACCCA CTAAGCAGCACCAACTACCG
PeGAI2_sRT-PCR GCATCTGATTCTGTCCATT TGGTCGGAGAAATCGATAG
PeGAI2_qRT-PCR GACCCCTCTGCTGATTCTT TATAGGTCTGTTTTTAA
EF1α_qRT-PCR GGCAAGGAGAAGGTACACAT CAATCACACGCTTGTCAATA
18S_sRT-PCR TCAACTTTCGATGGTAGGATAGTG CCGTGTCAGGATTGGGTAATTT