Skip to main content

Advertisement

Table 2 Primers, fragment sizes of EST-SSR

From: Genetic linkage map construction and QTL mapping of seedling height, basal diameter and crown width of Taxodium ‘Zhongshanshan 302’ × T. mucronatum

Primer name Forward primer (5′-3′) Reverse primer (5′-3′) Fragment size/bp
TA0106 ATCGTCATCGTCATCGTCCG TTGTTGAACCGGTGCTGGAT 218
TA0158 GTGCCGGTTTGGGAAATCAC ACCCCAAATCCACCTGCAAA 252
TA0178 GCCTTTTCTTCTCCCACCCT CACACCACCCACATTTGCAG 214
TA0197 GGTCAGGGGTTCGATTCTGG CCACGTTAGCAGGGTTCGAA 277
TA0208 TCTCACTGGTCGAAAGCCAC CAGAAGGGCCCAAATTCCGA 173
TA0210 GCTTGGAGGTGTTCGAGGAA GACCCCAGAGTGACAGTTGG 274
TA0214 AGGGGATTGGAAGGAGACGA ACGTATGTCACCATCCGCTG 240
TA0231 GGTGTTGGAGGAAGGCAAGA TAATGCCAGATGGTGCTGCA 188
TA0236 TCTTCTTCACCTACCCCCGT ACCGCCAAAATATCACCCGT 251
TA0283 CAAGCAGAGTCCAAGCCAGA TGCCTTCACCATGGCCTTAC 210
TA0310 CAGCGGATCCTCTCGATGAC ATCTAACCGGCAAACCTGGG 230
TA0400 GTAAAGGATTGAGCGCAGTGG ATGAAGCGCTCTTCCTCTGG 262
TA0430 GCAAGTTACGCCGAGCTTTC AGGCCCGTTTAATGCAGAGG 109
TA0438 CCGTTGTCTGCACGCAAAAT AATACCGGAAACCGCTCTGG 229
TA0440 GCCGTACCCTTTTCAGCTCT CCATGCCGAGACTTACCAGG 268
TA0443 AGATTGCTGGTACCTTGGGC ATTGGGCCCTCAGGATCTGA 181
TA0448 CCATGGCAGGCGCAAATATC TTTTGGATTCAACGCTGCCG 134