Skip to main content

Table 1 The relevant parameters of the fifteen reference genes

From: Identification and evaluation of reference genes in the Chinese white wax scale insect Ericerus pela

Gene symbol Gene name Primer sequences (5′–3′) Amplicon length (bp) Amplicon Tm (°C) Regressionco efficient (R2) Amplification efficiency (℅)
158 82 0.982 102.0
142 84.5 0.999 102.8
102 80.0 0.994 91.6
155 81.5 0.992 102.6
391 78.5 0.998 94.0
SdhA-1 Succinate dehydrogenase, subunit A F: CTAATGTTTCTACCAAGTCGGTAT
107 76 0.997 95.5
SdhA-2 Succinate dehydrogenase, subunit A F: CTAATGCGGCATTAATACCACCT
86 75 0.997 94.8
SdhA-3 Succinate dehydrogenase, subunit A F: GTATGCCACCCATATTGTAATGTAC
148 79 0.997 95.6
RP II RNA polymerase-II transcription F: ATTTTCTTCGCCCTCTTGCA
114 78.5 0.997 97.2
mRpL50-1 Mitochondrial ribosomal protein L50 F: CAGTATCAGGGTGGAATCTGTGATA
135 75.5 0.995 95.4
mRpL50-2 Mitochondrial ribosomal protein L50 F: AGTCCAACCATGGCCCTTATTAGCGA
148 78.5 0.999 91.0
mRpL15 Mitochondrial ribosomal protein L15 F: GTACGCAGTATTACGCTTGGGCATG
135 77.5 0.998 92.7
256 78.5 0.998 92.2
110 78 0.975 94.8
106 76.5 0.991 99.0