Skip to main content

Advertisement

Table 2 Oligonucleotide primers used in this study

From: Response of a Mu-class glutathione S-transferase from black tiger shrimp Penaeus monodon to aflatoxin B1 exposure

Primers Sequences (5′–3′) Sequence information
MuGST-F1 CCTACGAGATCTTCGACCAGCACCT Degenerate primers
MuGST-R1 CYYCTYCAYTTCRTATYTCTTCCTCT Degenerate primers
MuGST-F2 CAGGCTTTCCAGAAGAGGTTTG Nested degenerate primers
MuGST-R2 GATCGTAAACTGAGCGTACTTGTTGC Nested degenerate primers
PmMuGST-F1 CAGGAAGTACATGGCGTCCCCGGATTTC 3′ RACE PCR
PmMuGST-F2 GTAGATGGCTTGGTTTATGAAGAGGAAGA 3′ RACE-nested PCR
PmMuGST-R1 TTCTTCCTCTTCATAAACCAAGCCATCTAC 5′ RACE PCR
PmMuGST-R2 CCTGATGAAATCCGGGGACGCCATGTAC 5′ RACE-nested PCR
EF1A-F AGTATGCTCCTTTTGGACGTTTTGC Real-time PCR
EF1A-R CCTTTTCTGCGGCCTTGGTAGTC Real-time PCR
PmMuGST-F ACGGGCACTGAGTACGAGGAGAAG Real-time PCR
PmMuGST-R GGCAGATTTGGGAAAGCGAGG Real-time PCR
MuGST-EF CG GGATCCATGGTGCCTGTCCTGGG Recombinant expression
MuGST-ER CCC AAGCTTTCATTTTCCCTCAGCGATC Recombinant expression
  1. F and R stand for forward primers and reverse ones, respectively. MuGST-EF and MuGST-ER containing flanking non-complementary sequences (bold type) and the restriction sites (underlined). Y = C or T, R = A or G