Skip to main content

Table 1 List of bacterial strains, plasmids, and oligonucleotide primers utilized in this study

From: Development of an Escherichia coliLactobacillus casei shuttle vector for heterologous protein expression in Lactobacillus casei

Materials

Relevant properties

Source or reference

Bacteria

 Escherichia coli XL-1 Blue

White/blue screening

Stratagene, La Jolla, CA

 Lactobacillus casei TISTR1341

Source of pRCEID7.6 native plasmid

TISTR

 Lactobacillus casei RCEID02

Plasmid-free L. casei TISTR1341-derivative

Panya et al. (2012)

 Lactobacillus casei ATCC393

Plasmid-free stain

ATCC

Plasmids

 pUC19E

Apr, Emr, pUC19 carrying the Emr gene from pE194 at the SmaI site

Leenhouts et al. (1991)

 pGEM-T easy

Apr, M13ori, T-overhang cloning vector

Promega, MD, USA

 pRCEID-LC2.9

Apr, Emr, E. coli/L. casei shuttle vector based on pRCEID2.9

Panya et al. (2012)

 pRCEID-LC13.9Tc

Apr, Tcr, pRCEID-LC13.9 derivative, the Tcr gene was inserted at SacI site

Panya et al. (2012)

 pNZ8048

Cmr, NcoI site used for translational fusions, standard vector

Mierau and Kleerebezem (2005)

Oligonucleotides

Sequence (5′–3′)

 p6.8F-1

gggtcagttttgccttatg

This study

 P6.8R-1

ctggcaatgactttgcgga

This study

 p6.8F

attgcttggatcctctggcatgacaaac (BamHI)

This study

 p6.8R

ctttttggtatacggatccagtcgcta (KpnI)

This study

 SpeI-ldh_F

caaactagtagcttttagtcctcgtgaaaa (SpeI)

Suebwongsa et al. (2013)

 pnisNdeI

attacatatgaagctcgcgttatcggtc (NdeI)

Suebwongsa et al. (2013)

  1. Underlined nucleotides show introduced restriction enzyme sites, which are indicated in parenthesis
  2. TISTR Thailand Institute of Scientific and Technological Research, ATCC American Type Culture Collection