Skip to main content

Table 1 List of bacterial strains, plasmids, and oligonucleotide primers utilized in this study

From: Development of an Escherichia coliLactobacillus casei shuttle vector for heterologous protein expression in Lactobacillus casei

Materials Relevant properties Source or reference
Bacteria
 Escherichia coli XL-1 Blue White/blue screening Stratagene, La Jolla, CA
 Lactobacillus casei TISTR1341 Source of pRCEID7.6 native plasmid TISTR
 Lactobacillus casei RCEID02 Plasmid-free L. casei TISTR1341-derivative Panya et al. (2012)
 Lactobacillus casei ATCC393 Plasmid-free stain ATCC
Plasmids
 pUC19E Apr, Emr, pUC19 carrying the Emr gene from pE194 at the SmaI site Leenhouts et al. (1991)
 pGEM-T easy Apr, M13ori, T-overhang cloning vector Promega, MD, USA
 pRCEID-LC2.9 Apr, Emr, E. coli/L. casei shuttle vector based on pRCEID2.9 Panya et al. (2012)
 pRCEID-LC13.9Tc Apr, Tcr, pRCEID-LC13.9 derivative, the Tcr gene was inserted at SacI site Panya et al. (2012)
 pNZ8048 Cmr, NcoI site used for translational fusions, standard vector Mierau and Kleerebezem (2005)
Oligonucleotides Sequence (5′–3′)
 p6.8F-1 gggtcagttttgccttatg This study
 P6.8R-1 ctggcaatgactttgcgga This study
 p6.8F attgcttggatcctctggcatgacaaac (BamHI) This study
 p6.8R ctttttggtatacggatccagtcgcta (KpnI) This study
 SpeI-ldh_F caaactagtagcttttagtcctcgtgaaaa (SpeI) Suebwongsa et al. (2013)
 pnisNdeI attacatatgaagctcgcgttatcggtc (NdeI) Suebwongsa et al. (2013)
  1. Underlined nucleotides show introduced restriction enzyme sites, which are indicated in parenthesis
  2. TISTR Thailand Institute of Scientific and Technological Research, ATCC American Type Culture Collection