Development of an Escherichia coli – Lactobacillus casei shuttle vector for heterologous protein expression in Lactobacillus casei

SpringerPlus

Table 1 List of bacterial strains, plasmids, and oligonucleotide primers utilized in this study

Materials	Relevant properties	Source or reference
Bacteria
Escherichia coli XL-1 Blue	White/blue screening	Stratagene, La Jolla, CA
Lactobacillus casei TISTR1341	Source of pRCEID7.6 native plasmid	TISTR
Lactobacillus casei RCEID02	Plasmid-free L. casei TISTR1341-derivative	Panya et al. (2012)
Lactobacillus casei ATCC393	Plasmid-free stain	ATCC
Plasmids
pUC19E	Ap^r, Em^r, pUC19 carrying the Em^r gene from pE194 at the SmaI site	Leenhouts et al. (1991)
pGEM-T easy	Ap^r, M13ori, T-overhang cloning vector	Promega, MD, USA
pRCEID-LC2.9	Ap^r, Em^r, E. coli/L. casei shuttle vector based on pRCEID2.9	Panya et al. (2012)
pRCEID-LC13.9Tc	Ap^r, Tc^r, pRCEID-LC13.9 derivative, the Tc^r gene was inserted at SacI site	Panya et al. (2012)
pNZ8048	Cm^r, NcoI site used for translational fusions, standard vector	Mierau and Kleerebezem (2005)
Oligonucleotides	Sequence (5′–3′)
p6.8F-1	gggtcagttttgccttatg	This study
P6.8R-1	ctggcaatgactttgcgga	This study
p6.8F	attgcttggatcctctggcatgacaaac (BamHI)	This study
p6.8R	ctttttggtatacggatccagtcgcta (KpnI)	This study
SpeI-ldh_F	caaactagtagcttttagtcctcgtgaaaa (SpeI)	Suebwongsa et al. (2013)
pnisNdeI	attacatatgaagctcgcgttatcggtc (NdeI)	Suebwongsa et al. (2013)

Underlined nucleotides show introduced restriction enzyme sites, which are indicated in parenthesis
TISTR Thailand Institute of Scientific and Technological Research, ATCC American Type Culture Collection