Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in the construction of DNA clones of GVA and GVB genetic variants P163-M5 and 953-1, respectively, shown in Fig. 2

From: Brief report of the construction of infectious DNA clones of South African genetic variants of grapevine virus A and grapevine virus B

Virus Primer code Sequence (5′–3′) Amplified fragmenta
GVA P163-M5 5′Ca35S.F1 GGATCCCATGGAGTCAAAGATTC  
  3′Ca35S-5′M5.R GGGAATCAAGTTAAATATTCGAGTCCCCCGTGTTCTCTCC I
  3′Ca35S-5′M5.F GGAGAGAACACGGGGGACTCGAATATTTAACTTGATTCC  
  M5.573. Aat.R GCATTGGTGCTTATCCTC II
  M5.336.Aat.F CACATGCTCTATAGAGTTGCACC  
  M5.3512.Spe.R CTTGACCTGGTTAGAGCGA IV
  M5.2743.Spe.F AGGCTGACAGACTGGCGCGGAGC  
  M5.5403.Avr.R CACTCAACGTAGGACAAGGACTC V
  M5.4945.Avr.F ATGGCAAAGAGGAACGG  
  M5.T(30).R CATATGT(30)GTCATAGTATGACAACCTAGC VI
GVB 953-1 5′Ca35S.F2 ATGCGGCCGCCATGGAGTCAAAGATTC  
  3′Ca35S-5′953.R CGGAAGATTAAAGAAAAAGVGAACTTTATTGAGTCCCCCGTGTTCTCTCC I
  3′Ca35S-5′953.F GGAGAGAACACGGGGGACTCAATAAAGTTCGCTTTTTCTTTAATCTTCCG  
  953.880.Age.R ATGTGCTCCCTCTGGTGGCC II
  953.2704.Avr.R TGGCTCTTTGCTCGCACACC IVb
  953.2461.Avr.F AGGGGTGGTATGACACTTGG  
  953.5027.Xho.R CTAACCAGATCCTGCTGAGC V
  953.4838.Xho.F CGAGGATGAGCCCCTATGGC  
  953.T(35).R AGTTCGACT(35)TCGTGTTTATTCACGCTTCTTTCACC VI
  1. In bold are shown parts of the sequence of the CaMV 35S promoter in various orientations
  2. aSee Fig. 2. Fragments III of GVA P163-M5 and GVB 953-1 were PCR amplified using fragments I and II as templates, and primers pair 5′Ca35S.F1/M5.573.Aat.R and 5′Ca35S.F2/953.880.Age.R, respectively, according to the method described by Peremyslov and Dolja (2007)
  3. bFragment IV of GVB 953-1 was amplified using primers pair 3′Ca35S-5′953.F/953.2704.Avr.R