Skip to main content

Advertisement

Table 3 Primers used for sequencing of flanking regions and selection of homozygous plants

From: Expression and functional validation of heat-labile enterotoxin B (LTB) and cholera toxin B (CTB) subunits in transgenic rice (Oryza sativa)

Name Sequences (5′-3′)
Ada1 GCGTAATACGACTCACTATAGCAATTAACC
Ada2 GACTCACTATAGCAATTAAC
LB1an AAGCCGTCAGGAGCTCGAATTCAGTACA
LB2 CATTAAAAACGTCCGCAATG
RB1an AAGCTTGCTGAGTGGCTCCTTCAACG
RB2 GCTTGCTGAGTGGCTCCTTC
BP1 TATCAAAGAAGGCGGCAGGAGCCACCG
BP2 TGCCGTTTCCTGAGCACGCA
BP3 TATCAAAGAAGGCGGCAGGAGCC
LP1 TCGAAGCAGCCGATGAGCTTGA
LP2 TTGGCGTTCGGCTCCTGGAT
RB1 AGATTGTCGTTTCCCGCCTTC
RP1 TGGTATCATGGAAACGCGGGG
RP2 TCTTTAGACCCGTTGGGCCGTG
RP3 GAGAGAGATGATGTGGCATCTGACAC