Skip to main content

Advertisement

Table 2 Primer sets used to confirm the presence of genes

From: Expression and functional validation of heat-labile enterotoxin B (LTB) and cholera toxin B (CTB) subunits in transgenic rice (Oryza sativa)

Name Sequences (5′-3′)
Bar-F ACTACATCGAGACAAGCACGGT
Bar-R GCTCTACACCCACCTGCTGAAGT
CTB-F ATGGTGAAGCTCAAGTTCGG
CTB-R CTACTTTCCAAGTTGAGGTTC
LTB-F ATGGTGAAGGTGAAGTGCTAC
LTB-R ATCACATACCTCACCGAGAC
bar-F GCATGACGTTATTTATGAGATGGGTTTT
bar-R TGCGCGCTATATTTTGTTTTCTATCG
CT-F GTGTTCTTCACAGTTCTCCTCTCC
CT-R TCGTTGAGAGTATGAATTTGTGTGTTG
LT-F CCTCACCGAGACCAAGATTGATAAG
LT-R GTACCTCATAGCTCATCTTTCTCAGAG
Tnos-F TCCCGTCCGCTGGTG
Tnos-R TGCGCGCTATATTTTGTTTTCTATCG
Actin-F CAGCCCCTCGTCTGCGATAA
Actin-R GCCGACGTAGGCGTCCTTCT