Skip to main content

Table 1 Primers used in molecular confirmation study

From: Isolation, identification and characterization of Burkholderia pseudomallei from soil of coastal region of India

Primer name Primer sequences Annealing temperature Amplification size Purpose/Reference
VMP 23-1-F 5′ CTTTTGGGTCATCCTRGA 3′ 48°C 1,051 bp Identification (Bauernfeind et al., 1998)
MP 23-2-R 5′ TCCTACCATGCGAGACT 3′
BPTTS1-F 5′CGTCTCTATACTGTCGAGCAATCG 3′ 58°C 548 bp Identification (Novak et al., 2006)
BPTTS1-R 5′ CGTGCACACCGGTCAGTATC 3′
F8 5′ AGTTTGATCCTGGCTCAG 3′ 50°C 1,488 bp 16S sequencing (Gee et al., 2003)
R1492 5′ ACCTTGTTACGACTT 3′
fli C-F 5′ CTCGGATCCAACAGCAAC 3′ 52°C 1,167 bp PCR-RFLP (Primer designed)
fli C-R R- 5′ TATTGCAGGTACCTTCAG 3′