Skip to main content

Table 4 Primers used for qRT-PCR analysis

From: Activated and inactivated immune responses in Caenorhabditis elegans against Photorhabdus luminescens TT01

  Primer name Sequence
1. F08G5.6_For 5’ – ATCGTTCCGAATGGTGGTTGAC – 3’
2. F08G5.6_Rev 5’ – GCCGATTTCAGCTTGCAAAGTG – 3’
3. T24B8.5_For 5’ – AAACCTGTGGTGTCTGCGTTAC – 3’
4. T24B8.5_Rev 5’ – TGGCAGGTTTTTGGGCATTG – 3’
5. lys-2_For 5’ – TGCTGATTTCCGTGCTTTCG – 3’
6. lys-2_Rev 5’ – TTCCAACAGCATACACGTCACG – 3’
7. clec-67_For 5’ – AATGTTCAATCGGCCACCCTTG – 3’
8. clec-67_Rev 5’ – TGGTCATGTTGAAGACGTTCGC – 3’
9. spp-1_For 5’ – TTTGCTGGACTATGCTGTTGCC – 3’
10. spp-1_Rev 5’ – AACATCCTTGCACGCCTTGTC – 3’
11. thn-2_For 5’ – TCCAACTTACGGCTGGACAATC – 3’
12. thn-2_Rev 5’ – TGCATTGCTCCGAGTTTCTGC – 3’
13. lys-7_For 5’ – AATGTGCCGTCAAACTTGGC – 3’
14. lys-7_Rev 5’ – TGCACGAACGAAAACTGCAC – 3’
15. ins-7_For 5’ – TTAGGTCCAGCAGAACCAGAAG – 3’
16. ins-7_Rev 5’ – CGCATGCTTTTCCACAAACCG – 3’
17. snb-1_For 5’ – TGGAGCGTGATCAGAAGTTGTC – 3’
18. snb-1_Rev 5’ – TCCACCAATACTTGCGCTTCAG – 3’