Skip to main content

Table 3 Primers used for RNAi constructs」

From: Activated and inactivated immune responses in Caenorhabditis elegans against Photorhabdus luminescens TT01

  Primer name Sequence
1. daf-16a_BamHI_For 5’ – GGGGATCCGCCGGAGCCACGTGGCAGGTG – 3’
2. daf-16a_SalI_Rev 5’ – ATACGCGTCGACTCAGCTCATGTCTGATCAATG – 3’
3. daf-2_SalI_For 5’ – GGAGCACGATATTGTCGACGGCA – 3’
4. daf-2_XbaI_Rev 5’ – GCTCTAGATTTCTGAACAGTGACTTTGCCT – 3’
5. pmk-1_EcoRI_For 5’ – GGGAATTCCACAGACAACAATGGATCATAT – 3’
6. pmk-1_EcoRI_Rev 5’ – AAGGAATTCTTCATCTGGTGTTCC – 3’