Skip to main content

Table 1 Sequences of SCAR primers, PCR condition and product size

From: Molecular cloning and development of RAPD-SCAR markers for Dimocarpus longan variety authentication

SCAR 5′-primer Sequence (5′-3′) 3′-primer Sequence (5′-3′) Size (bp) Tm (°C)
LY2-1 LY2-1 L AACTGGAAGTCCCTGGTCCT LY2-1R ACAAGAGGCCCCAGTAAGGT 350 60
LY4-7 LY4-7 L GGCGCCGGTATACTTTGTAA LY4-7R CTCGTAAGAGGATCCGTCCA 367 60
LY4-8 LY4-8 L CCCCATCTGGTTGTAGCACT LY4-8R AGCCAGCTCAACCAACTCAT 358 60
LY5-2 LY5-2 L TTTTAATGTTGGGCATTTGG LY5-2R GCTAACCGAGATCCACTAACG 250 60