Skip to main content

Advertisement

Table 1 Primers used for Real-Time PCR analysis

From: Proliferative effect and osteoinductive potential of extracellular matrix coated on cell culture plates

Gene Primer sequence (5′-3′) length(bps)
Runx2 F:AGTAGCCAGGTTCAACGAT 90
  R:GGAGGATTTGTGAAGACTGTT  
OCN F:AGTCTGACAAAGCCTTCA 134
  R:AAGCAGGGTTAAGCTCACA  
GAPDH F: ACCCATCACCATCTTCCAGGAG 159
  R: GAAGGGGCGGAGATGATGAC