Skip to main content

Table 1 Primers for detecting carbapenemases of class A and two selected class D subgroups

From: Acinetobacter baumannii producing OXA-23 detected in the Czech Republic

Primer Sequence Product size (bp) Ta Reference
(5′→3′)
SME-F AGATAGTAAATTTTATAG 1138 50°C Radice et al.; 2004
SME-R CTCTAACGCTAATAG
IMI-F ATAGCCATCCTTGTTTAGCTC 818 50°C Queenan et al.; 2000
IMI-R TCTGCGATTACTTTATCCTC
NMC1 GCATTGATATACCTTTAGCAGAGA 2158 50°C Aubron et al.; 2005
NMC4 CGGTGATAAAATCACACTGAGCATA
KPC-F ATGTCACTGTATCGCCGTCT 893 60°C Bradford et al.; 2004
KPC-R TTTTCAGAGCCTTACTGCCC
GES-F GTTTTGCAATGTGCTCAACG 371 50°C Weldhagen et al.; 2004
GES-R TGCCATAGCAATAGGCGTAG
OXA-23 F AAGCATGATGAGCGCAAAG 1066 50°C Donald et al.; 2000
OXA-23R AAAAGGCCCATTTATCTCAAA
OXA-48 F TTGGTGGCATCGATTATCGG 744 50°C Poirel et al., 2004
OXA-48R GAGCACTTCTTTTGTGATGGC
  1. Legend: Ta – annealing temperature.