Skip to main content

Table 1 Specific primers used in RT-PCR

From: Gene expression responses in Suaeda salsa after cadmium exposure

Gene   Primers (5′-3′) Length of amplicon (bp)
Actin (BE231408) Forward ATCCGCAAAGATTACATACCATA 254
Reverse TTGTTCACCGAAAGTGCTTCT
Prx Q (AY373447) Forward GCACAAGGCATTCAAACAGAAG 160
Reverse AACAAGTCGGACAACACCGT
GST (BE859255) Forward TCCGCAAAGATTACATACCATA 293
Reverse GTGGATCTCCAAGGGCGAGTA
MIPS (BE644574) Forward CTTCTTCGTTTTCCCCTCTT 155
Reverse AGCCTTTGCGATTCTCGT
CAT1 (AF390210) Forward ACTTCCCATCAAGATACGACCCT 256
Reverse GATTTGTCAGCCTGAGACCAGTA
CAT2 (AY046530) Forward GGACTTTCGCCTATGCTGAT 265
Reverse CCTGGCTCCTTGAAGTTATTC
Nhx1 (AY261806) Forward TGTTGCTGTGAGTTCCATATT 208
  Reverse TGTGTGCCCTGACCTTGA