Skip to main content

Table 2 Details of SSR loci used in the present study and their genetic diversity parameters

From: Genetic structure and diversity of indigenous rice (Oryza sativa) varieties in the Eastern Himalayan region of Northeast India

Primer name Chr SSR motif Forward 5-3 Reverse 5-3 N a H e
RM302 1 (GT)30(AT)8 TCATGTCATCTACCATCACAC ATGGAGAAGATGGAATACTTGC 10 0.805
RM341 2 (CTT)20 CAAGAAACCTCAATCCGAGC CTCCTCCCGATCCCAATC 19 0.861
RM130 3 (GA)10 TGTTGCTTGCCCTCACGCGAAG GGTCGCGTGCTTGGTTTGGTTC 4 0.419
RM307 4 (AT)14(GT)21 GTACTACCGACCTACCGTTCAC CTGCTATGCATGAACTGCTC 9 0.749
RM169 5 (GA)12 TGGCTGGCTCCGTGGGTAGCTG TCCCGTTGCCGTTCATCCCTCC 14 0.798
RM204 6 CT)44 GTGACTGACTTGGTCATAGGG GCTAGCCATGCTCTCGTACC 18 0.866
RM264 8 (GA)27 GTTGCGTCCTACTGCTACTTC GATCCGTGTCGATGATTAGC 21 0.884
  1. Chr, Chromosome location; Na, Observed number of alleles; He, Nei (1973) genetic diversity.