Skip to main content

Table 2 Sequences of the primers used in the work

From: PepT1 mRNA expression levels in sea bream (Sparus aurata) fed different plant protein sources

Primer Sequence 5 – 3 Purpose
PepT1-sense1 GATGACTTCGCCACCACTA RT-PCR
PepT1-antisense1 CGATCAGATGCAGACGGTG RT-PCR
PepT1-sense2 AGCAGGGCTCAAGATGGAC RT-PCR
PepT1-antisense2 ACATCATCGTGCTCATCGTG RT-PCR
PepT1_T7promoter gtaatacgactcactataggg GGAGTGTGGTATTCACA mRNA std.curve
PepT1_antisense3 AGCAGGGCTCAAGATGGAC mRNA std.curve
PepT1 - sense GCTACCCTCTGGCCTTTGG Real-time
PepT1 - antisense ATGGTGGTAGCTCTGATTGTGTTC Real-time
Taqman PepT1 TCCCCGCTGCTCTC Real-time