Skip to main content

Advertisement

Table 2 Sequence variations of element of x-HGP from 21 species in Triticeae and outgroups, y-HGP from four species of Hordeum

From: Characterization of x-type high-molecular-weight glutenin promoters (x-HGP) from different genomes in Triticeae

Species E motif N motif Partial Enhancer Enhancer TATA box Start
  (TGTAAAGT) (TGAGTCAT) (TTTGCAAA) (GTTTTGCAAAGCTCCAATTGCTCCTTGCTT ATCCAGCT) (CTATAAAAG) (TTATCA)
TRUR TGTAAATC TGAGTCAT TTTGCAAA GTTTTACAAAGCTCCAATTGCTCCTTGCTTATCCAGCT CTATAAAAG TCTTCA
TRBO TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT CTATAAAAG TCCTCA
AEBI TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTTCTTATCTAGCT CTATAAAAG TCATCA
AELO TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTTCTTATCTAGCT CTATAAAAG TCATCA
AESE TGTAAATC TGAGTCAT TTTACAAA GTTTTGCAAAGCTCCAATTGCTCCGTGCTTATCTAGCT CTATAAAAG TCGTCA
AESH TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTTCTTATCTAGCT CTATAAAAG TCATCA
AESP TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAA-GCTCCAATTGCTCCTTGCTTATCTAGCT CTATAAAAG TCGTCA
AETA TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT CTATAAAAG TTATCA
THBE TGTAAATC TGAGTCAT TTTGCAAA -TTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGCT CTATAAAAA TCATCA
THEL TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGCT CTATAAAAA TCATCA
ERBO TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGCT CTATAAAAG TCATCA
AECO TGTAAATC TGAGTCAT TTTGCAAA GTTTCGCAAAGCTCCAATTGCTCCTTTCTTATCTAGCT CTATAAAAG TCATCA
PSHU TGTAAGTT TGAGTCAT TTTGCAAG GTTTCGCAAAGCTCCAATTGCCCCTTGCTTATCTAGCT CTATAAAAG TCATCA
HEPE TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATTCAGCT CTATAAAAG TCATCA
AGCR TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT CTATAAAAG TCATCA
SESY TGTAAGTC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGTT CTATAAAAG TCATCA
SEST TGTAAGTC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGTT CTATAAAAG TCATCA
SECE TGTAAGTC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGCT CTATAAAAG TCATCA
AEUN TGTAAATC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGTTCCTTGCTTATCCAGCT CTATAAAAG TCATCA
TACA TGTAAATC TGAGTCAT TTTGCAAA GTCTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT CTATAAAAG TCATCA
AEUM TGTAAACC TGAGTCAT TTTGCAAA GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT CTATAAAAG TTATCA
HOBO TGTAAATG TGAGTCAT deleted GTTTTGCAAAGCTCCAATTGCACCTTGCTTATCCAGCT CTATAAAAG TCATCA
HOBR TGTAAATG TGAGTCAT deleted GTTTTGCAAAGCTCCAATTGCACCTTGCTTATCCAGCT CTATAAAAG TCATCA
HOBU TGTAAATC TGAGTCAT deleted ATTTTGCAAAGCTCCAATTGCACCTCGCTTATCCAACT CTATAAAAG TCATCA
HOSP TGTAAATC TGAGTCAT deleted GTTTTGCAAAGCTCCAATTGCACCTCGCTTATCCAACT CTATAAAAG TCATCA
  1. The positions of variation were underlined in the corresponding loci of consensus sequences.