Skip to main content

Table 1 Primers for amplification of the HPV L1 gene and chimeric variants

From: Expression of human papillomavirus 6b L1 protein in silkworm larvae and enhanced green fluorescent protein displaying on its virus-like particles

Primers 5’ – 3’
HPV 6b L1-F CACCATGTGGCGGCCTCGCGACAGC
HPV 6b L1-R TTACCTTTTAGTTTTGGCGCG
HPV 6b L1 short-R TTAAACACCTGTACGAATAGAGG
Eco-HPV 6b L1-F CGGAATTCATGTGGCGGCCTCGCGACAGC
HPV 6b L1-55R-LINKER TGTACCACCACCACCGCTACCACCACCACCGTTAGCCCGTTTTATGGA
HPV 6b L1 LINKER-56F GGAGGAGGAGGAAGCGGAGGAGGAGGAAAAACTGTTGTGCCAAAGGTG
Kpn-HPV 6b L1-R GGGGTACCTTACCTTTTAGTTTTGGCGCG
HPV 6b L1-174R-LINKER TGTACCACCACCACCGCTACCACCACCACCAGGTGTATTAGTACACTG
HPV 6b L1 LINKER-175F GGAGGAGGAGGAAGCGGAGGAGGAGGAGTACAGGCTGGTGACTGCCCG
HPV 6b L1-348R-LINKER TGTACCACCACCACCGCTACCACCACCACCGGAAGATGTAGTTACGGA
HPV 6b L1 LINKER-349F GGAGGAGGAGGAAGCGGAGGAGGAGGAACATACACCAATTCTGATTAT
LINKER-EGFP-F GGTGGTGGTGGTAGCGGTGGTGGTGGTACAATGGTGAGCAAGGGCGAG
EGFP-R-LINKER TCCTCCTCCTCCGCTTCCTCCTCCTCCCTTGTACAGCTCGTCCATGCC