Open Access

Characterization of x-type high-molecular-weight glutenin promoters (x-HGP) from different genomes in Triticeae

  • Qian-Tao Jiang1,
  • Quan-Zhi Zhao1,
  • Xiu-Ying Wang1,
  • Chang-Shui Wang1,
  • Shan Zhao1,
  • Xue Cao1,
  • Xiu-Jin Lan1,
  • Zhen-Xiang Lu1, 2,
  • You-Liang Zheng3 and
  • Yu-Ming Wei1Email author
SpringerPlus20132:152

DOI: 10.1186/2193-1801-2-152

Received: 16 February 2013

Accepted: 4 April 2013

Published: 10 April 2013

Abstract

The sequences of x-type high-molecular-weight glutenin promoter (x-HGP) from 21 diploid Triticeae species were cloned and sequenced. The lengths of x-HGP varied from 897 to 955 bp, and there are 329 variable sites including 105 singleton sites and 224 polymorphic sites. Genetic distances of pairwise X-HGP sequences ranged from 0.30 to 16.40% within 21 species and four outgroup species of Hordeum. All five recognized regulatory elements emerged and showed higher conservation in the x-HGP of 21 Triticeae species. Most variations were distributed in the regions among or between regulatory elements. A 22 bp and 50 bp insertions which were the copy of adjacent region with minor change, were found in the x-HGP of Ae. speltoides and Ps. Huashanica, and could be regarded as genome specific indels. The phylogeny of media-joining network and neighbour-joining tree both supported the topology were composed of three sperate clusters. Especially, the cluster I comprising the x-HGP sequences of Aegilops, Triticum, Henrardia, Agropyron and Taeniatherum was highly supporting by both network and NJ tree. As conferring to higher level and temporal and spatial expression, x-HGP can used as the source of promoter for constructing transgenic plants which allow endosperm-specific expression of exogenous gene on higher level. In addition, the x-HGP has enough conservation and variation; so it should be valuable in phylogenetic analyses of Triticeae family members.

Keywords

Evolution analysis Regulatory element Triticeae x-type high-molecular-weight glutenin promoter (x-HGP)

Introduction

In wheat and its relatives, high-molecular-weight glutenin subunits (HMW-GSs) are one of the most important storage proteins in seed endosperm as their significant effects on wheat processing quality (Lawrence and Shepherd 1980;Payne 1987; Shewry et al.1992). HMW-GSs are critical in determining wheat gluten and dough elasticity which promote the formation of the larger glutenin polymer (Shewry et al.1995). The genes encoding for HMW-GSs are designated as Glu-1 loci locating on the long arms of the Group 1 chromosomes in bread wheat. Each Glu-1 locus consists of 2 tightly linked genes encoding an x-type subunit with a larger molecular weight and a y-type subunit with a smaller one, respectively (Payne 1987). Up to now, a lot of studies have been conducted in identifications and function analysis of HMW-GS genes from wheat and its wild relatives (Anderson and Greene 1989; Forde et al.1985; Halford et al.1987; Jiang et al.2012a; Jiang et al.2012b; Jiang et al.2009; Liu et al.2003, 2007, 2008, 2010; Sugiyama et al.1985; Thompson et al.1985; Wan et al.2005).

HMW-GS genes and other seed protein encoding genes share similar expression pattern of tissue-specific and developmental regulation even though they have different regulatory elements (Lamacchia et al.2001;Shewry and Halford 2002). Previous studies indicated that high-molecular-weight glutenin promoter (HGP) contains five recognized regulatory elements, they are transcription start site, TATA box, complete HMW enhancer, partial HMW enhancer, the prolamin box like element which is composed of two relatively conserved motifs: the endosperm motif (E motif) and the GCN4-like motif (N motif)(Hammond-Kosack et al.1993; Müller andKnudsen 1993). Based on the regulation of these elements, the encoding genes of HMW-GS exhibit a higher expression level than those of other seed storage proteins (Lamacchia et al.2001). The grasses of the Triticeae tribe include huge number of wheat and its relatives, which has been widely researched as genetic resource for wheat quality improvement programs. For example, previous reports revealed that wild species has abundant HMW-GS variants which confers to different structural feature and expression level from those of common wheat (Jiang et al.2012a; Liu et al.2010; Wan et al.2002;2005).

In previous study, we have characterized y-type HGP and its cis regulatory elements from 25 Triticeae species (Jiang et al.2010). In this study, we further reported the characterization of x-type high-molecular-weight glutenin promoter (x-HGP) in 21 diploid Triticeae species. The objective of this study is to investigate molecular information for x-HGP in 21 diploid species of Triticeae, and characterize regulatory elements, and explore phylogenetic relationship among x-HGP of different species of Triticeae.

Materials and methods

Plant materials

Twenty-one diploid species of Triticeae were investigated in this study, and four Hordeum species were used as outgroup (Table 1). The accessions with PI numbers were kindly provided by USDA-ARS (http://www.ars-grin.gov/npgs/). The accessions with AS numbers were deposited at Triticeae Research Institute, Sichuan Agricultural University, China.
Table 1

The 25 diploid species of Triticeae used in this study

Accession

Taxon

Abbreviation

Genome

Origin

GenBank

References

PI428311

Triticum urartu Tumanian ex Gandilyan

TRUR

Au

Beqaa, Lebanon

KC478921

This study

PI428007

Triticum monococcum L. subsp.aegilopoides (Link) Thell.

TRBO

Am

Arbil, Iraq

KC478922

This study

CIae 70

Aegilops bicornis (Forsskal) Jaub. & Spach

AEBI

Sb

Unknown

KC478923

This study

PI 604122

Aegilops longissima (Schweinf. & Muschl.) Á. Löve.

AELO

Sl

Central, Israel

KC478924

This study

PI599149

Aegilops searsii (Feldman & Kislev ex Hammer) Á. Löve

AESE

Ss

Southern, Israel

KC478925

This study

PI 584388

Aegilops sharonensis (Eig) Á. Löve.

AESH

Ssh

Haifa, Israel

KC478926

This study

PI560531

Aegilops speltoides (Tausch) Á.Löve

AESP

S

Turkey

KC478927

This study

PI603230

Aegilops tauschii (Coss) Á. Löve.

AETA

D

Azerbaijan

KC478928

This study

PI531711

Thinopyrum bessarabicum (Savul. & Rayss) A. Love

THBE

Eb

Ukraine

KC478929

This study

PI 578683

Thinopyrum elongatum (Host) D. R. Dewey

THEL

Ee

Nebraska

KC478930

This study

PI219966

Eremopyrum bonaepartis (Spreng.) Nevski

ERBO

F

Afghanistan

KC478931

This study

PI276970

Aegilops comosa

AECO

M

Greece

KC478932

This study

PI531823

Psathyrostachys huashanica Keng

PSHU

Ns

Shanxi, China

KC478933

This study

PI577112

Henrardia persica (Boiss.) C. E. Hubb

HEPE

O

Turkey

KC478934

This study

PI277352

Agropyron cristatum (L.) Grossh

AGCR

P

Former Soviet Union

KC478935

This study

PI283983

Secale sylvestre

SESY

R

Former Soviet Union

KC478936

This study

PI205222

Secale strictum

SEST

R

Eskisehir, Turkey

KC478937

This study

PI168199

Secale cereale

SECE

R

Isparta, Turkey

KC478938

This study

AS136

Aegilops uniaristata Vis

AEUN

N

Unknown

KC478939

This study

PI220590

Taeniatherum caput-medusae

TACA

Ta

Afghanistan

KC478940

This study

AS2

Aegilops umbellulata Zhuk

AEUM

U

Unknown

KC478941

This study

PI 499645

Hordeum bogdanii Wilensky

HOBO

H

Xinjiang, China

EU074248

Jiang et al.2010

PI383667

Hordeum brevisubulatum Bothmer

HOBR

H

Erzurum, Turkey

EU074247

Jiang et al.2010

PI401357

Hordeum bulbosum

HOBU

I

Iran

EU074249

Jiang et al.2010

PI466482

Hordeum spontaneaum (K. Koch) Thell

HOSP

I

Israel

EU074250

Jiang et al.2010

Isolation and sequencing of x-HGP from Triticeae species

Genomic DNA was extracted from the leaves of two-week-old single plant by using CTAB extraction method (Murray and Thompson 1980). To design x-type specific primers, we aligned the published sequences of HMW glutenin genes 1Ax1 (GenBank: X61009), 1Ax2* (GenBank: M22208), 1Bx7 (GenBank: X13927), 1Bx17 (GenBank: JC2099), 1Dx2 (GenBank: X03346), 1Dx5 (GenBank: X12928), 1Ay (GenBank: X03042) 1By9 (GenBank: X61026), 1Dy10 (GenBank: X12929), and 1Dy12 (GenBank: X03041). According to the results of alignment, a pair of primers (HGPF and HGPxR) was designed to specifically amplify x-HGP. The HGPF1 primer (5-AGGGAAAGACAATGGACATG -3) was designed from the sequence which was highly conserved in the 5 upstream regions of both x- type and y- type HGP, whereas the HGPxR1 primer (5- GTCTCGGAGC/TTGC/TTGGTC-3) was targeted to the sequence coding for six amino acid residues (DQQLRD) which appear only in the N-terminal domain of x-type HMW-GSs (Figure 1). The amplification profile was 94°C for 5 min, followed by 35 cycles of 94°C for 45 sec, 60°C for 1 min, and 72°C for 2 min 30 sec, and a final extension step at 72°C for 10 min. High-fidelity LA Taq polymerase (Takara, Dalian, China) was used in the PCR reactions to avoid introducing errors into the sequence. The amplified products were separated by 1.0% agarose gels. Purified PCR products were then ligated into pMD19-T vector (Takara, Dalian China). The amplified products were purified and ligated into the pMD19-T vector (TaKaRa, Dalian, China). The cloned fragments were sequenced in both directions by a commercial company (Invitrogen, Shanghai, China). The sequencing results of three independent clones at least were used to determine the final nucleotide sequence of each species. All the DNA sequences have been deposited into the NCBI database with the GenBank accession numbers from KC478921 to KC478941 (Table 1).
Figure 1

Schematic structure of HMW glutenin gene promoter and the strategy of cloning. The regulatory elements were indicated by boxes, E: E motif, N: N motif, PE: partial HMW enhancer, EN: complete HMW enhancer, TA: TATA box. The specific primers (HGPF and HGPxR) for amplifying x-type HMW glutenin gene promoter and their target region are marked. The deletion of regulatory element partial enhancer in y-type HMW glutenin gene promoter of some species is also indicated by broken lines.

Data analyses

The sequence prediction was performed by DNAman software package (Version 5. 2. 10; Lynnon Biosoft). The sequence alignment was carried out with Clustal W Version 1.83(Thompson et al.1994). The alignment was further improved by visual examination and manual adjustment. The y-HGP sequences of four Hordeum species were used as outgroup. The genetic distance was calculated by using the software Mega (Version 4.02) with the parameters, nucleotide model: Kimura 2-parameter, and substitution: Transitions + Transversions (Tamura et al.2007). To enhance the comparison between wheat and its relatives, the sites with informative variations were used to construct media-joining network in program Network 4.6.1.1 (http://www.fluxus-engineering.com) with the following parameters of weights = 10, epsilon = 0 and the transversions /transitions ratio was set to 3:1 (Allaby and Brown 2001; Bandelt et al.1999). The media-joining network was calculated under the parameters of weights = 10, epsilon = 0 and the transversions /transitions ratio was set to 3:1 (Allaby and Brown 2001). The neighbour-joining (NJ) tree was constructed to estimate the possibility of phylogenetic clade, under the substitute model of Maximum Composite Likelihood; gaps were treated as missing data. To estimate the topological robustness, the bootstrap values were calculated based on 1000 replications.

Results

Sequence variation and structural characteristics of x-HGP

In genomic PCR, there is only one fragment of approximately 1200 bp were amplified in each of 21 diploid Triticeae species by using the x-HGP specific primers HGPF1 + HGPxR1 (Figure 2). The PCR fragments were cloned and sequenced. And the final x-HGP sequence of each species was assembled by at least three independent clones. The results of sequencing showed that the lengths of x-HGP from which the sequences encoding signal peptide and partial N-terminal varied from 897 to 955 bp. The x-HGP sequences were different from each other by substitutions, insertions and deletions of single or more nucleotides. Although there is difference in DNA sequences, the x-HGP exhibit higher conservation among different genomes of Triticeae. For all the sequences, there are 329 variable sites including 105 singleton sites and 224 polymorphic sites, of which 192sites were informative (Figure 3). According to the sequence characteristics and location of identified elements, we characterized all five recognized regulatory elements and summarized their variations in Table 2. The sequences of these regulatory elements showed higher conservation, for example, the N motif share perfect identical sequences among all 21 species of Triticeae. The sequence variations of rest of elements only resulted from single or few base substitutions except for single base deletion in the motif Enhancer of Aegilops speltoides and Thinopyrum bessarabicum. The insertions and deletions (Indels) was the main cause of length variation of x-HGP among 21 species. Most variations distributed in the regions among or between regulatory elements. A few genome specific indels were also characterized in Ae. speltoides and Psathyrostachys huashanica (Figure 4a, b). A 22 bp and 50 bp insertions were found in the x-HGP of Ae. speltoides and Ps. huashanica. These inserted fragments are the copies of adjacent region, of which the duplication has some mutation involving single base pair in Ps. huashanica (Figure 4c, d).
Figure 2

PCR amplification of x-HGP from partial of 21 Triticeae species. Line 1–12: T. urartu, T. monococcum L. subsp.aegilopoides, Ae. bicornis, Ae. longissima, Ae. sharonensis, Ae. speltoides, Ae. tauschii, Ps. huashanica, Se. cereale, Ta. caput-medusae, Th. Elongatum and Th. Elongatum; M is DNA marker.

Figure 3

The nucleotide variations in the sequences of x-HGP from 21 Tritceae species and y-HGP of Hordeu m. The number at the top of figure indicated the variation position. See Table 1 for species abbreviations.

Table 2

Sequence variations of element of x-HGP from 21 species in Triticeae and outgroups, y-HGP from four species of Hordeum

Species

E motif

N motif

Partial Enhancer

Enhancer

TATA box

Start

 

(TGTAAAGT)

(TGAGTCAT)

(TTTGCAAA)

(GTTTTGCAAAGCTCCAATTGCTCCTTGCTT ATCCAGCT)

(CTATAAAAG)

(TTATCA)

TRUR

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTACAAAGCTCCAATTGCTCCTTGCTTATCCAGCT

CTATAAAAG

TCTTCA

TRBO

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT

CTATAAAAG

TCCTCA

AEBI

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTTCTTATCTAGCT

CTATAAAAG

TCATCA

AELO

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTTCTTATCTAGCT

CTATAAAAG

TCATCA

AESE

TGTAAATC

TGAGTCAT

TTTACAAA

GTTTTGCAAAGCTCCAATTGCTCCGTGCTTATCTAGCT

CTATAAAAG

TCGTCA

AESH

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTTCTTATCTAGCT

CTATAAAAG

TCATCA

AESP

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAA-GCTCCAATTGCTCCTTGCTTATCTAGCT

CTATAAAAG

TCGTCA

AETA

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT

CTATAAAAG

TTATCA

THBE

TGTAAATC

TGAGTCAT

TTTGCAAA

-TTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGCT

CTATAAAAA

TCATCA

THEL

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGCT

CTATAAAAA

TCATCA

ERBO

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGCT

CTATAAAAG

TCATCA

AECO

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTCGCAAAGCTCCAATTGCTCCTTTCTTATCTAGCT

CTATAAAAG

TCATCA

PSHU

TGTAAGTT

TGAGTCAT

TTTGCAAG

GTTTCGCAAAGCTCCAATTGCCCCTTGCTTATCTAGCT

CTATAAAAG

TCATCA

HEPE

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATTCAGCT

CTATAAAAG

TCATCA

AGCR

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT

CTATAAAAG

TCATCA

SESY

TGTAAGTC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGTT

CTATAAAAG

TCATCA

SEST

TGTAAGTC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGTT

CTATAAAAG

TCATCA

SECE

TGTAAGTC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTACTTATCCAGCT

CTATAAAAG

TCATCA

AEUN

TGTAAATC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGTTCCTTGCTTATCCAGCT

CTATAAAAG

TCATCA

TACA

TGTAAATC

TGAGTCAT

TTTGCAAA

GTCTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT

CTATAAAAG

TCATCA

AEUM

TGTAAACC

TGAGTCAT

TTTGCAAA

GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAGCT

CTATAAAAG

TTATCA

HOBO

TGTAAATG

TGAGTCAT

deleted

GTTTTGCAAAGCTCCAATTGCACCTTGCTTATCCAGCT

CTATAAAAG

TCATCA

HOBR

TGTAAATG

TGAGTCAT

deleted

GTTTTGCAAAGCTCCAATTGCACCTTGCTTATCCAGCT

CTATAAAAG

TCATCA

HOBU

TGTAAATC

TGAGTCAT

deleted

ATTTTGCAAAGCTCCAATTGCACCTCGCTTATCCAACT

CTATAAAAG

TCATCA

HOSP

TGTAAATC

TGAGTCAT

deleted

GTTTTGCAAAGCTCCAATTGCACCTCGCTTATCCAACT

CTATAAAAG

TCATCA

The positions of variation were underlined in the corresponding loci of consensus sequences.

Figure 4

Multiple sequence alignment of x-HGP of 21 Triticeae diploid species and four species of Hordeum as outgroup. The species-specific indels were indicated by boxes, a, partial HMW enhancer appears in all x-HGP of all 21 species, but deleted in those of four Hordeum; b and c, d represent unique indels in Psathyrostachys and Aegilops. The inserted fragments in Psathyrostachys and Aegilops are duplication of adjacent region.

The number of transitions and transversions are listed in Table 3. The transitions/transversions ratios of the x-HGP sequences varied from 0 to 21, showing the nucleotide substitution rates were unequal within Triticeae. Genetic distances of pairwise X-HGP sequences ranged from 0.30 to 16.40% within 21 species and four outgroup species of Hordeum (Table 3). The pairwise x-HGP divergence values were low and were coincided to higher conservation of x-HGP sequences in different genomes of Triticeae.
Table 3

Pairwise comparisons of nucleotide substitutions and genetic distances of x-HGP sequences of 21 Triticeae species and y-HGP sequences of four Hordeum species

 

TACP

AESP

SESY

AEBI

AECO

AELO

AESH

AETA

AESE

AEUM

AEUN

AGCR

THBE

THEL

ERBO

HOBO

HOBR

HOBU

HOSP

HEPE

PSHU

SEST

SECE

TRBO

TRUR

TACP

 

4.70

8.60

5.50

5.10

5.50

5.30

5.10

5.80

5.50

5.00

1.70

7.20

6.40

5.00

15.70

14.60

13.50

14.30

2.10

11.10

8.50

8.30

5.70

5.80

AESP

34/9

 

8.40

2.40

2.10

2.40

2.20

2.30

1.00

3.00

2.50

3.80

6.90

6.10

5.00

14.60

13.40

13.70

14.20

5.00

10.70

8.20

8.10

4.60

4.80

SESY

51/22

53/17

 

8.90

8.50

8.80

8.50

8.50

9.50

8.90

8.50

8.50

5.30

5.00

3.90

15.80

14.90

14.80

15.30

9.10

11.20

0.40

0.50

9.20

9.00

AEBI

34/15

14/5

51/22

 

0.90

1.00

0.80

3.10

3.50

3.90

3.10

4.60

7.50

6.80

5.70

15.20

14.30

14.80

15.30

5.80

11.40

8.80

8.60

5.70

5.90

AECO

31/13

12/5

50/20

4/3

 

0.60

0.40

2.70

3.10

3.50

2.70

4.20

7.10

6.40

5.30

14.70

13.80

14.30

14.80

5.40

10.60

8.30

8.20

5.30

5.50

AELO

34/14

15/4

51/21

5/3

5/0

 

0.30

3.10

3.50

3.90

2.80

4.60

7.10

6.40

5.50

15.20

14.30

14.80

15.30

5.80

11.40

8.60

8.50

5.70

5.90

AESH

32/14

13/4

49/20

3/3

3/0

2/0

 

2.80

3.20

3.60

2.60

4.30

7.10

6.40

5.30

14.90

14.00

14.50

14.90

5.50

11.10

8.30

8.20

5.40

5.70

AETA

34/14

18/3

55/18

18/8

16/7

19/7

17/7

 

3.40

3.20

1.10

3.90

7.20

6.50

5.40

15.00

13.80

14.30

14.80

5.40

10.90

8.50

8.40

5.50

5.50

AESE

40/11

7/2

60/19

20/8

19/6

22/6

14/2

20/5

 

4.10

3.50

4.70

7.80

6.60

6.10

15.70

14.60

15.00

15.50

6.00

11.90

9.40

9.20

5.40

5.70

AEUM

36/17

18/5

54/22

23/10

21/9

24/9

22/9

22/8

28/7

 

3.40

4.30

7.80

6.90

5.80

15.20

13.80

14.30

14.60

5.80

11.70

8.80

8.60

6.00

6.20

AEUN

36/12

21/1

56/18

22/6

19/5

20/5

18/5

6/4

28/3

30/5

 

4.00

7.10

6.20

5.10

14.60

13.40

13.90

14.30

5.30

10.50

8.40

8.20

5.40

5.50

AGCR

13/3

27/8

53/21

29/12

17/11

30/11

28/11

26/10

33/10

30/12

30/8

 

7.10

6.20

4.80

15.30

13.90

13.40

14.00

1.70

10.70

8.40

8.20

5.80

5.90

THBE

43/21

34/15

31/15

39/19

41/19

42/18

43/18

43/19

47/18

46/20

44/17

42/20

 

1.10

2.70

14.90

13.60

13.70

14.10

7.60

10.60

5.10

5.00

7.90

8.00

THEL

37/22

37/15

31/15

37/21

35/19

35/20

34/20

39/19

39/19

39/21

40/17

37/20

7/2

 

2.20

14.70

13.50

13.10

13.50

6.80

10.30

4.90

4.70

7.00

7.20

ERBO

29/15

31/10

26/9

32/15

30/14

32/14

30/14

34/13

39/12

36/15

35/11

30/14

17/7

12/8

 

13.50

12.20

11.40

12.10

5.40

9.20

3.80

3.60

6.10

6.20

HOBO

67/47

67/40

71/47

68/43

66/42

69/42

67/42

68/42

70/43

70/41

69/39

69/45

63/47

63/48

57/44

 

3.90

9.60

10.20

15.80

16.40

16.00

15.50

15.80

16.00

HOBR

64/43

62/35

71/45

63/41

61/40

64/40

67/40

63/39

68/35

64/36

64/35

63/41

59/43

58/44

53/40

23/8

 

8.70

9.00

14.70

15.20

14.70

14.60

15.00

15.00

HOBU

65/33

70/31

76/36

71/34

69/34

74/33

70/34

73/33

76/31

71/32

66/27

68/33

66/37

64/37

56/33

49/29

45/28

 

1.30

13.90

14.30

14.70

14.50

14.50

14.10

HOSP

63/37

68/34

83/45

70/39

67/38

70/38

68/37

70/37

74/36

68/37

71/33

60/32

67/40

61/41

55/37

47/33

40/31

8/4

 

14.60

14.80

15.10

14.90

14.90

14.70

HEPE

16/1

35/10

55/22

36/16

34/14

37/14

35/14

36/13

41/12

39/15

36/11

12/3

46/20

40/21

33/15

69/43

66/42

68/34

37/38

 

11.40

8.90

8.80

6.40

6.50

PSHU

61/33

60/30

63/39

59/34

56/34

61/32

59/34

60/33

67/32

63/35

60/31

59/31

58/37

56/37

51/32

68/53

64/49

71/39

69/43

64/30

 

11.10

10.90

12.40

12.60

SEST

53/21

52/17

3/0

51/22

49/20

51/21

49/21

55/18

59/19

54/21

52/18

53/20

33/15

30/15

24/9

72/47

67/43

75/36

73/39

55/22

62/39

 

0.40

8.80

9.20

SECE

52/22

51/17

4/0

49/23

48/21

50/21

48/21

54/18

58/19

53/22

53/18

51/20

31/11

29/15

24/9

69/28

66/43

74/35

70/40

54/22

60/39

3/0

 

8.60

9.00

TRBO

34/18

29/10

52/25

32/15

30/14

33/14

31/14

35/13

33/13

37/15

37/10

35/17

44/24

38/24

33/17

69/47

67/43

68/37

69/37

39/18

66/26

50/25

49/25

 

1.70

TRUR

32/20

27/12

46/27

31/17

24/16

32/16

30/16

33/15

33/13

36/17

35/13

33/19

42/21

36/24

32/20

68/49

66/44

66/39

64/42

37/20

65/39

49/27

49/32

10/4

 

Note: Percentage of sequence divergence using genetic distance is shown in the upper diagonal. Direct counts of transitions/transversions are shown in the lower diagonal. Species abbreviations are listed in Table 1.

Phylogenetic analyses

The media-joining network analysis for 21 x-HGP and four y-HGP from different Triticeae genomes showed that the formed phylogeny is composed of three separate clusters (Figure 5). In the cluster I, the HGP of Ae. bicornis, Ae. comosa, Ae. longissima, Ae. searsii, Ae. sharonensis, Ae. speltoides, Ae. tauschii, Ae. uniaristata, Ae. umbellulata, T. urartu, T. boeoticum, Henrardia persica, Agropyron cristatum and Taeniatherum caput-medusae were inclued. The x-HGP of all Aegilops formed the biggest subcluster around which two minor clade comprising Triticum, and Henrardia persica, Agropyron cristatum and Taeniatherum caput-medusae emerged (at the top of Figure 5). The second cluster is composed of Secale sylvestre, Se. strictum, Se. cereale, Th. bessarabicum, Th. elongata and Eremopyrum bonaepartis, and the x-HGP of Secale and Thinopyrum species formed a separate clade, respectively (in the middle of Figure 5). For the third cluster, it’s composed of y-HPG of four Hordeum, and this cluster was further divided into two clades, one includes species of H. bogdanii and H. brevisubulatum with genome H, the other contains H. bulbosum and H. spontaneaum with the genome I (at the bottom of Figure 5).
Figure 5

The media-joining network derived from the x-HGP sequences from 21 diploid species of Triticeae and four y-HPG sequences of Hordeum. The x-HGP of all Aegilops formed the biggest subcluster around which two minor clade comprising Triticum, and He. persica, Ag. cristatum and Ta. caput-medusae emerged at the top of network. The topology was cluster into three main separate groups with placing PSHU aside the group II.

The resulted neighbour-joining (NJ) trees showed highly identical topology to media-joining network (Figure 6), strongly supporting placement of three clusters. In addition, these clusters are also supported by high bootstrap values, indicating that strong statistic support for the reliability of phylogeny.
Figure 6

The neighbor-joining (NJ) tree derived from x-HGP sequences from 21 diploid species of Triticeae. The NJ tree was constructed by using the substitute model of Maximum Composite Likelihood. The bootstrap values were calculated based on 1000 replications to estimate the topological robustness.

Discussions

As a key factor in wheat quality, HMW-GS is one of most important storage protein in wheat seed. Although they only hold about 10% of seed storage proteins, the allelic variation in HMW-GS compositions has been reported to account for up to 70% of the variation in bread making quality among European wheats (Halford et al.1992;Payne 1987; Wan et al.2002). Apart from allelic variations in HMW-GS genes, variation in promoter regions of these genes also very useful to distinguish between the genes and gives better evolutionary studies among Triticeae family members (Anderson et al.1998). Two ways were adopted to ensure the accuracy of results. Firstly, the high fidelity polymerase was used to ensure to avoid the potential mistakes introduced into the amplified fragments in genomic PCR. Secondly, to exclude probable errors in sequencing, each nucleotide sequence of x-HGP was determined by using sequencing results of multiple independent clones. Therefore, the molecular information we generated for x-HGP is reliable and effective for exploring structural variation and evolution among different species of Triticeae.

The structure variations and evolution of x-HGP

HMW-GS genes are different from other prolamin genes at a higher expressional level. Under the regulation of high-molecular-weight glutenin promoter (HGP), single active HMW-GS gene encodes a subunit accounting for approximate 2% of total protein in mature wheat seed (Halford et al.1992). This indicates that HGP confer to higher expression to HMW-GS gene. In our previous study of y-HGP from Triticeae, we found the regulatory element Partial Enhancer was deleted in eight species of T. urartu, T. boeotum, Ae. umbellulata, Ae. uniaristata, H. bulbosum, H. spontaneum, H. bogdanii and H. brevisubulatum (Jiang et al.2010). In this study, the Partial Enhancer appeared in x-HGP of all 21 species of Triticeae (Figure 4a). The obvious variations were two large insertions in spacer region between regulatory elements within x-HGP of Ae. speltoides and Ps. huashanica. And the inserted fragments are the copy of adjacent region with minor variations (Figure 4c, d). The 85 bp-fragment deletion in the promoter region of inactive HMW subunit gene 1Ay had been regarded as the possible reason for silencing of this allele (Halford et al.1989). Our previous study revealed that this fragment has also been deleted in the active 1Ay genes (Jiang et al.2009). Previous study indicated that the 185 bp insertion in 1Bx7 promoter do not affect the expressions of HMW-GS genes (Harberd et al.1987). We found that HMW-GS genes were usually disrupted by the variations in ORFs, such as premature stop codons, large transposon-like elements, etc. (Harberd et al.1987; Jiang et al.2012b; Jiang et al.2009). Therefore, the 22 bp and 50 bp insertion located in the regions between elements may not affect the expressions of HMW-GS genes. We conclude that this high conservation of regulatory elements is coincided to keep the tissue specificity and expression level of HMW-GS gene.

Phylogenetic analysis of x-HGP among different species of Triticeae

There is only one D-hordein gene in Hordeum, which was orthologous of HMW-GS wheat and showing homology to y-type HMW-GS (Gu et al.2003). Sequence analysis indicated that the y-HGP sequences of Hordeum shared homology in composition of regulatory elements with that of x-HGP of 21 Triticeae species, and have enough variations (supported by average distance of 12.60 among Hordeum and other species) among them. Therefore, using the sequences of Hordeum y-HGP as outgroups was suitable in phylogenetic analysis. The resulted media-joining network and neighbour-joining tree both supported the topology were composed of three sperate clusters. The cluster I, the biggest group, was highly supporting by both network and NJ tree, mainly including the x-HGP of all nine species of Aegilops, two species of Triticum, then He. persica, Ag. cristatum and Ta. caput-medusae were place aside. This group is high similar to the ones, Aegilops-Triticum complex and the Mediterranean clade identified in y-HGP and ITS phlylogenetic analysis, respectively(Hsiao et al.1995; Jiang et al.2010). It could be explained by their similar distribution in Mediterranean and neighbor regions. The x-HGP of Thinopyrum, Secale and Hordeum were clustered as subcluster according to their same genome. The genus Hordeum contains about 31 diploid and polyploid species, and four sections were determined by morphological characters (von Bothmer et al.1995). Previous phylogenetic analysis by using ITS sequences has revealed four major clades that coincide with the four genome designations in Hordeum (Blattner,2004, 2006). In our study, the x-HGP phylogenetic analysis also support the similar clades in Hordeum, respectively. Our results confirmed that x-HGP, like y-HGP and ITS, all can generate a good resolution to phylogenetic relationships within Triticeae.

In conclusion, according to the results of x-HGP sequences from 21 species in Triticeae, we conclude the x-HGP would be beneficial: 1) to drive exogenous gene to expresson on temporal and spatial pattern; 2) to serve as a valuable candidate in phylogenetic analyses of Triticeae.

Declarations

Acknowledgement

This work was supported by the National Natural Science Foundation of China (31000167 and 31230053) and China Transgenic Research Program (2011ZX08002-001,004 and 005).

Authors’ Affiliations

(1)
Triticeae Research Institute, Sichuan Agricultural University
(2)
Lethbridge Research Centre, Agriculture and Agri-Food Canada
(3)
Key Laboratory of Southwestern Crop Germplasm Utilization, Ministry of Agriculture

References

  1. Allaby RG, Brown TA: Network analysis provides insights into evolution of 5S rDNA arrays in Triticum and Aegilops. Genetics 2001, 157: 1331-1341.Google Scholar
  2. Anderson O, Greene F: The characterization and comparative analysis of high-molecular-weight glutenin genes from genomes A and B of a hexaploid bread wheat. Theor Appl Genet 1989, 77: 689-700.View ArticleGoogle Scholar
  3. Anderson OD, Abraham-Pierce FA, Tam A: Conservation in wheat high-molecular-weight glutenin gene promoter sequences: comparisons among loci and among alleles of the Glu-B1-1 locus. Theor Appl Genet 1998, 96: 568-576. 10.1007/s001220050775View ArticleGoogle Scholar
  4. Bandelt HJ, Forster P, Röhl A: Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol 1999, 16: 37-48. 10.1093/oxfordjournals.molbev.a026036View ArticleGoogle Scholar
  5. Blattner FR: Phylogenetic analysis of Hordeum (Poaceae) as inferred by nuclear rDNA ITS sequences. Mol Phylogenet Evol 2004, 33: 289-299. 10.1016/j.ympev.2004.05.012View ArticleGoogle Scholar
  6. Blattner FR: Multiple intercontinental dispersals shaped the distribution area of Hordeum (Poaceae). New Phytol 2006, 169: 603-614. 10.1111/j.1469-8137.2005.01610.xView ArticleGoogle Scholar
  7. von Bothmer R, Jacobsen N, Baden C, Jorgensen RB, Linde-Laursen I: An ecogeographical study ofthe genus Hordeum. Systematic and ecogeographical studies on crop genepools, 7. 2nd edition. IPGRI, Rome; 1995.Google Scholar
  8. Forde J, Malpica JM, Halford NG: The nucleotide sequence of an HMW glutenin subunit gene located on chromosome 1A of wheat. Nucleic Acids Res 1985, 13: 6817-6832. 10.1093/nar/13.19.6817View ArticleGoogle Scholar
  9. Gu YQ, Anderson OD, Londeorë CF, Kong XY, Chibbar RN, Lazo GR: Structural organization of the barley D-hordein locus in comparison with its orthologous regions of wheat genomes. Genome 2003, 46: 1084-1097. 10.1139/g03-071View ArticleGoogle Scholar
  10. Halford N, Forde J, Anderson O, Greene F, Shewry P: The nucleotide and deduced amino acid sequences of an HMW glutenin subunit gene from chromosome 1B of bread wheat (Triticum aestivum L.) and comparison with those of genes from chromosomes 1A and 1D. Theor Appl Genet 1987, 75: 117-126.View ArticleGoogle Scholar
  11. Halford NG, Field JM, Blair H, Urwin P, Moore K, Robert L, Thompson R, Flavell RB, Tatham AS, Shewry PR: Analysis of HMW glutenin subunits encoded by chromosome 1A of bread wheat (Triticum aestivum L.) indicates quantitative effects on grain quality. Theor Appl Genet 1992, 83: 373-378.View ArticleGoogle Scholar
  12. Hammond-Kosack MCU, Holdsworth MJ, Bevan MW: In vivo footprinting of a low molecular weight glutenin gene (LMWG‐1D1) in wheat endosperm. EMBO J 1993, 12: 545-554.Google Scholar
  13. Halford NG, Forde J, Shewry PR, Kreis M: Functional analysis of the upstream regions of a silent and an expressed member of a family of wheat seed protein genes in transgenic tobacco. Plant Sci 1989, 62: 207-216. 10.1016/0168-9452(89)90083-6View ArticleGoogle Scholar
  14. Harberd NP, Flavell RB, Thompson RD: Identification of a transposon like insertion in a Glu-1 allele of wheat. Mol Gen Genet 1987, 209: 326-332. 10.1007/BF00329661View ArticleGoogle Scholar
  15. Hsiao C, Chatterton NJ, Asay KH: Phylogenetic relationships of the monogenomic species of the wheat tribe, Triticeae (Poaceae), inferred from nuclear rDNA (internal transcribed spacer) sequences. Genome 1995, 38: 211-221. 10.1139/g95-026View ArticleGoogle Scholar
  16. Jiang QT, Ma J, Wei YM, Liu YX, Lan XJ, Dai SF, Lu ZX, Zhao S, Zhao QZ, Zheng YL: Novel variants of HMW glutenin subunits from Aegilops section Sitopsis species in relation to evolution and wheat breeding. BMC Plant Biol 2012, 12: 73. 10.1186/1471-2229-12-73View ArticleGoogle Scholar
  17. Jiang QT, Ma J, Zhao S, Zhao QZ, Lan XJ, Dai SF, Lu ZX, Zheng YL, Wei YM: Characterization of HMW-GSs and their gene inaction in tetraploid wheat. Genetica 2012, 140: 325-335. 10.1007/s10709-012-9683-4View ArticleGoogle Scholar
  18. Jiang QT, Wei YM, Wang F, Wang JR, Yan ZH, Zheng YL: Characterization and comparative analysis of HMW glutenin 1Ay alleles with differential expressions. BMC Plant Biol 2009, 9: 16. 10.1186/1471-2229-9-16View ArticleGoogle Scholar
  19. Jiang QT, Wei YM, Wang JR, Yan ZH, Zheng YL: Molecular diversity and phylogenetic analyses of y-type high-molecular-weight glutenin promoters from different genomes in Triticeae. Plant Syst Evol 2010, 285: 131-138. 10.1007/s00606-009-0263-8View ArticleGoogle Scholar
  20. Lamacchia C, Shewry PR, Fonzo ND, Forsyth JL, Harris N, Lazzeri PA, Napier JA, Halford NG, Barcelo P: Endosperm-specific activity of a storage protein gene promoter in transgenic wheat seed. J Exp Bot 2001, 52: 243-250. 10.1093/jexbot/52.355.243View ArticleGoogle Scholar
  21. Lawrence GJ, Shepherd KW: Variation in glutenin protein subunits in wheat. Australian J Agric Res 1980, 33: 221-233.Google Scholar
  22. Liu S, Zhao F, Gao X, Chen F, Xia G: A novel high molecular weight glutenin subunit from Australopyrum retrofractum. Amino Acids 2010, 39: 385-392. 10.1007/s00726-009-0450-5View ArticleGoogle Scholar
  23. Liu SW, Gao X, Xia GM: Characterizing HMW-GS alleles of decaploid Agropyron elongatum in relation to evolution and wheat breeding. Theor Appl Genet 2008, 116: 325-334. 10.1007/s00122-007-0669-zView ArticleGoogle Scholar
  24. Liu SW, Zhao SY, Chen FG, Xia GM: Generation of novel high quality HMW-GS genes in two introgression lines of Triticum aestivum/Agropyron elongatum. BMC Evol Biol 2007, 7: 76. 10.1186/1471-2148-7-76View ArticleGoogle Scholar
  25. Liu ZJ, Yan ZH, Wan YF, Liu KF, Zheng YF, Wang DW: Analysis of HMW glutenin subunits and their coding sequences in two diploid Aegilops species. Theor Appl Genet 2003, 106: 1368-1378.Google Scholar
  26. Müller M, Knudsen S: The nitrogen response of a barley C‐hordein promoter is controlled by positive and negative regulation of the GCN4 and endosperm box. Plant J 1993, 4: 343-355. 10.1046/j.1365-313X.1993.04020343.xView ArticleGoogle Scholar
  27. Murray M, Thompson WF: Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 1980, 8: 4321-4325. 10.1093/nar/8.19.4321View ArticleGoogle Scholar
  28. Payne PI: Genetics of wheat storage proteins and the effect of allelic variation on breadmaking quality. Ann Rev Plant Physiol 1987, 38: 141-153. 10.1146/annurev.pp.38.060187.001041View ArticleGoogle Scholar
  29. Shewry PR, Halford NG: Cereal seed storage proteins: structures, properties and role in grain utilization. J Exp Bot 2002, 53: 947-958. 10.1093/jexbot/53.370.947View ArticleGoogle Scholar
  30. Shewry PR, Halford NG, Tatham AS: The high molecular weight subunits of wheat glutenin. J Cereal Sci 1992, 15: 105-110. 10.1016/S0733-5210(09)80062-3View ArticleGoogle Scholar
  31. Shewry PR, Tatham AS, Barro F, Barcelo P, Lazzeri P: Biotechnology of breadmaking: unraveling and manipulating the multi-protein gluten complex. Nat Biotech 1995, 13: 1185-1190. 10.1038/nbt1195-1185View ArticleGoogle Scholar
  32. Sugiyama T, Rafalski A, Peterson D, Soll D: A wheat HMW glutenin subunit gene reveals a highly repeated structure. Nucleic Acids Res 1985, 13: 8729-8737. 10.1093/nar/13.24.8729View ArticleGoogle Scholar
  33. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007, 24: 1596-1599. 10.1093/molbev/msm092View ArticleGoogle Scholar
  34. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994, 22: 4673-4680. 10.1093/nar/22.22.4673View ArticleGoogle Scholar
  35. Thompson R, Bartels D, Harberd N: Nucleotide sequence of a gene from chromosome 1D of wheat encoding a HMW-glutenin subunit. Nucleic Acids Res 1985, 13: 6833-6846. 10.1093/nar/13.19.6833View ArticleGoogle Scholar
  36. Wan YF, Wang DW, Shewry PR, Halford NG: Isolation and characterization of five novel high molecular weight subunit of glutenin genes from Triticum timopheevi and Aegilops cylindrical. Theor Appl Genet 2002, 104: 828-839. 10.1007/s00122-001-0793-0View ArticleGoogle Scholar
  37. Wan YF, Yan ZH, Liu KF, Zheng YL, D'Ovidio R, Shewry PR, Halford NG, Wang D: Comparative analysis of the D genome-encoded high molecular weight subunits of glutenin. Theor Appl Genet 2005, 111: 1183-1190. 10.1007/s00122-005-0051-yView ArticleGoogle Scholar

Copyright

© Jiang et al.; licensee Springer. 2013

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Comments